ID: 1122707186

View in Genome Browser
Species Human (GRCh38)
Location 14:103628925-103628947
Sequence GCAGGGCGCGGCTCGCGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 7, 3: 44, 4: 457}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122707186_1122707199 12 Left 1122707186 14:103628925-103628947 CCACCCCGCGAGCCGCGCCCTGC 0: 1
1: 0
2: 7
3: 44
4: 457
Right 1122707199 14:103628960-103628982 ACCCCCGTCCGCGTTACAACCGG 0: 1
1: 0
2: 0
3: 2
4: 5
1122707186_1122707201 13 Left 1122707186 14:103628925-103628947 CCACCCCGCGAGCCGCGCCCTGC 0: 1
1: 0
2: 7
3: 44
4: 457
Right 1122707201 14:103628961-103628983 CCCCCGTCCGCGTTACAACCGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1122707186_1122707207 24 Left 1122707186 14:103628925-103628947 CCACCCCGCGAGCCGCGCCCTGC 0: 1
1: 0
2: 7
3: 44
4: 457
Right 1122707207 14:103628972-103628994 GTTACAACCGGGAGGCCCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 31
1122707186_1122707205 16 Left 1122707186 14:103628925-103628947 CCACCCCGCGAGCCGCGCCCTGC 0: 1
1: 0
2: 7
3: 44
4: 457
Right 1122707205 14:103628964-103628986 CCGTCCGCGTTACAACCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 2
1122707186_1122707208 25 Left 1122707186 14:103628925-103628947 CCACCCCGCGAGCCGCGCCCTGC 0: 1
1: 0
2: 7
3: 44
4: 457
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122707186 Original CRISPR GCAGGGCGCGGCTCGCGGGG TGG (reversed) Intronic