ID: 1122707198 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:103628958-103628980 |
Sequence | GGTTGTAACGCGGACGGGGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 26 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 24} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1122707198_1122707207 | -9 | Left | 1122707198 | 14:103628958-103628980 | CCACCCCCGTCCGCGTTACAACC | 0: 1 1: 0 2: 0 3: 1 4: 24 |
||
Right | 1122707207 | 14:103628972-103628994 | GTTACAACCGGGAGGCCCGCTGG | 0: 1 1: 0 2: 0 3: 0 4: 31 |
||||
1122707198_1122707208 | -8 | Left | 1122707198 | 14:103628958-103628980 | CCACCCCCGTCCGCGTTACAACC | 0: 1 1: 0 2: 0 3: 1 4: 24 |
||
Right | 1122707208 | 14:103628973-103628995 | TTACAACCGGGAGGCCCGCTGGG | 0: 1 1: 0 2: 0 3: 0 4: 25 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1122707198 | Original CRISPR | GGTTGTAACGCGGACGGGGG TGG (reversed) | Intronic | ||