ID: 1122707201

View in Genome Browser
Species Human (GRCh38)
Location 14:103628961-103628983
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 22}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122707186_1122707201 13 Left 1122707186 14:103628925-103628947 CCACCCCGCGAGCCGCGCCCTGC 0: 1
1: 0
2: 7
3: 44
4: 457
Right 1122707201 14:103628961-103628983 CCCCCGTCCGCGTTACAACCGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1122707191_1122707201 -4 Left 1122707191 14:103628942-103628964 CCCTGCCCCGAGCGCCCCACCCC 0: 1
1: 0
2: 6
3: 91
4: 815
Right 1122707201 14:103628961-103628983 CCCCCGTCCGCGTTACAACCGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1122707187_1122707201 10 Left 1122707187 14:103628928-103628950 CCCCGCGAGCCGCGCCCTGCCCC 0: 1
1: 0
2: 6
3: 45
4: 464
Right 1122707201 14:103628961-103628983 CCCCCGTCCGCGTTACAACCGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1122707188_1122707201 9 Left 1122707188 14:103628929-103628951 CCCGCGAGCCGCGCCCTGCCCCG 0: 1
1: 0
2: 4
3: 44
4: 441
Right 1122707201 14:103628961-103628983 CCCCCGTCCGCGTTACAACCGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1122707193_1122707201 -9 Left 1122707193 14:103628947-103628969 CCCCGAGCGCCCCACCCCCGTCC 0: 1
1: 0
2: 3
3: 29
4: 498
Right 1122707201 14:103628961-103628983 CCCCCGTCCGCGTTACAACCGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1122707182_1122707201 28 Left 1122707182 14:103628910-103628932 CCAGGGCCTGGCCGCCCACCCCG 0: 1
1: 0
2: 6
3: 65
4: 719
Right 1122707201 14:103628961-103628983 CCCCCGTCCGCGTTACAACCGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1122707183_1122707201 22 Left 1122707183 14:103628916-103628938 CCTGGCCGCCCACCCCGCGAGCC 0: 1
1: 1
2: 3
3: 36
4: 325
Right 1122707201 14:103628961-103628983 CCCCCGTCCGCGTTACAACCGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1122707194_1122707201 -10 Left 1122707194 14:103628948-103628970 CCCGAGCGCCCCACCCCCGTCCG 0: 1
1: 0
2: 2
3: 20
4: 296
Right 1122707201 14:103628961-103628983 CCCCCGTCCGCGTTACAACCGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1122707184_1122707201 17 Left 1122707184 14:103628921-103628943 CCGCCCACCCCGCGAGCCGCGCC 0: 1
1: 0
2: 2
3: 476
4: 4109
Right 1122707201 14:103628961-103628983 CCCCCGTCCGCGTTACAACCGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1122707189_1122707201 8 Left 1122707189 14:103628930-103628952 CCGCGAGCCGCGCCCTGCCCCGA 0: 1
1: 1
2: 6
3: 28
4: 259
Right 1122707201 14:103628961-103628983 CCCCCGTCCGCGTTACAACCGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1122707185_1122707201 14 Left 1122707185 14:103628924-103628946 CCCACCCCGCGAGCCGCGCCCTG 0: 1
1: 0
2: 0
3: 17
4: 183
Right 1122707201 14:103628961-103628983 CCCCCGTCCGCGTTACAACCGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1122707190_1122707201 1 Left 1122707190 14:103628937-103628959 CCGCGCCCTGCCCCGAGCGCCCC 0: 1
1: 0
2: 10
3: 125
4: 962
Right 1122707201 14:103628961-103628983 CCCCCGTCCGCGTTACAACCGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1122707192_1122707201 -5 Left 1122707192 14:103628943-103628965 CCTGCCCCGAGCGCCCCACCCCC 0: 1
1: 0
2: 24
3: 838
4: 3535
Right 1122707201 14:103628961-103628983 CCCCCGTCCGCGTTACAACCGGG 0: 1
1: 0
2: 0
3: 0
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type