ID: 1122707208

View in Genome Browser
Species Human (GRCh38)
Location 14:103628973-103628995
Sequence TTACAACCGGGAGGCCCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122707198_1122707208 -8 Left 1122707198 14:103628958-103628980 CCACCCCCGTCCGCGTTACAACC 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1122707187_1122707208 22 Left 1122707187 14:103628928-103628950 CCCCGCGAGCCGCGCCCTGCCCC 0: 1
1: 0
2: 6
3: 45
4: 464
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1122707195_1122707208 1 Left 1122707195 14:103628949-103628971 CCGAGCGCCCCACCCCCGTCCGC 0: 1
1: 0
2: 1
3: 36
4: 447
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1122707190_1122707208 13 Left 1122707190 14:103628937-103628959 CCGCGCCCTGCCCCGAGCGCCCC 0: 1
1: 0
2: 10
3: 125
4: 962
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1122707196_1122707208 -6 Left 1122707196 14:103628956-103628978 CCCCACCCCCGTCCGCGTTACAA 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1122707197_1122707208 -7 Left 1122707197 14:103628957-103628979 CCCACCCCCGTCCGCGTTACAAC 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1122707189_1122707208 20 Left 1122707189 14:103628930-103628952 CCGCGAGCCGCGCCCTGCCCCGA 0: 1
1: 1
2: 6
3: 28
4: 259
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1122707193_1122707208 3 Left 1122707193 14:103628947-103628969 CCCCGAGCGCCCCACCCCCGTCC 0: 1
1: 0
2: 3
3: 29
4: 498
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1122707184_1122707208 29 Left 1122707184 14:103628921-103628943 CCGCCCACCCCGCGAGCCGCGCC 0: 1
1: 0
2: 2
3: 476
4: 4109
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1122707194_1122707208 2 Left 1122707194 14:103628948-103628970 CCCGAGCGCCCCACCCCCGTCCG 0: 1
1: 0
2: 2
3: 20
4: 296
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1122707188_1122707208 21 Left 1122707188 14:103628929-103628951 CCCGCGAGCCGCGCCCTGCCCCG 0: 1
1: 0
2: 4
3: 44
4: 441
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1122707192_1122707208 7 Left 1122707192 14:103628943-103628965 CCTGCCCCGAGCGCCCCACCCCC 0: 1
1: 0
2: 24
3: 838
4: 3535
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1122707185_1122707208 26 Left 1122707185 14:103628924-103628946 CCCACCCCGCGAGCCGCGCCCTG 0: 1
1: 0
2: 0
3: 17
4: 183
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1122707191_1122707208 8 Left 1122707191 14:103628942-103628964 CCCTGCCCCGAGCGCCCCACCCC 0: 1
1: 0
2: 6
3: 91
4: 815
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1122707186_1122707208 25 Left 1122707186 14:103628925-103628947 CCACCCCGCGAGCCGCGCCCTGC 0: 1
1: 0
2: 7
3: 44
4: 457
Right 1122707208 14:103628973-103628995 TTACAACCGGGAGGCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122707208 Original CRISPR TTACAACCGGGAGGCCCGCT GGG Intronic