ID: 1122717620

View in Genome Browser
Species Human (GRCh38)
Location 14:103705171-103705193
Sequence GGCCACATCCCTTTTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122717613_1122717620 15 Left 1122717613 14:103705133-103705155 CCGCTTGAGGCCAGGAACGTATA 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1122717620 14:103705171-103705193 GGCCACATCCCTTTTGTGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 113
1122717612_1122717620 16 Left 1122717612 14:103705132-103705154 CCCGCTTGAGGCCAGGAACGTAT 0: 1
1: 0
2: 0
3: 9
4: 73
Right 1122717620 14:103705171-103705193 GGCCACATCCCTTTTGTGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 113
1122717614_1122717620 5 Left 1122717614 14:103705143-103705165 CCAGGAACGTATAAATACTGCCT 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1122717620 14:103705171-103705193 GGCCACATCCCTTTTGTGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122717620 Original CRISPR GGCCACATCCCTTTTGTGGC TGG Intronic
900264944 1:1752780-1752802 GGCCACTTCCTTTCTGTAGCTGG - Exonic
900931417 1:5740217-5740239 GGCCACACACCTTTTGTCTCTGG - Intergenic
903739447 1:25550134-25550156 GGCCTCATCCCTCCTGTGGGCGG - Intronic
908560996 1:65306446-65306468 TGCCACATCACTTTTGGGGTGGG - Intronic
909139269 1:71843203-71843225 AGCAACATCCTATTTGTGGCAGG + Intronic
915396744 1:155590735-155590757 GGCCTCAGGCCTTTTGTTGCTGG - Intergenic
919554044 1:199029375-199029397 GGCCACAGACCTTTTGGGGAAGG + Intergenic
920160042 1:203990308-203990330 GGACACACCCCATTTATGGCGGG + Intergenic
921220272 1:212968700-212968722 GGCCCCAACTCTTTAGTGGCAGG + Intronic
921742862 1:218706446-218706468 CACCACATCCCTTTTCTGTCTGG - Intergenic
922610270 1:226921639-226921661 GGCCAGATTCCTTTTCGGGCTGG + Intronic
1063483707 10:6399797-6399819 GGCCACATCTCTGTTCTGCCTGG - Intergenic
1064154742 10:12894590-12894612 GACCACATCCACTTTGTGTCTGG + Intergenic
1064655992 10:17556744-17556766 GGCACCATCCATTTTGGGGCAGG - Intergenic
1073638125 10:105220339-105220361 CGCCACATCCTTTTTGTGTTTGG + Intronic
1074399008 10:113126576-113126598 CGCCCCCTCCCTTTTGTGGGGGG + Intronic
1077470053 11:2753420-2753442 GGGCACATGCCTTTTCTGGGAGG - Intronic
1082763338 11:57147275-57147297 AACCACATCACTTTTGGGGCTGG + Intergenic
1085728598 11:78976875-78976897 TGCCAAATACCTTTTGTGTCTGG + Intronic
1087652771 11:100887769-100887791 GGGCACATCCCTCCTGAGGCAGG + Intronic
1089557648 11:119323420-119323442 ACCCACATCCCTCTGGTGGCTGG - Intergenic
1095232467 12:39757170-39757192 GTCCAAATCCCTATTGAGGCTGG - Exonic
1100286060 12:93168017-93168039 GGTAAAACCCCTTTTGTGGCTGG - Intergenic
1115304704 14:31922244-31922266 GGCATTATCCCTTTAGTGGCTGG - Intergenic
1118767895 14:68922327-68922349 AGCCAGATCCCATCTGTGGCAGG - Intronic
1122717620 14:103705171-103705193 GGCCACATCCCTTTTGTGGCTGG + Intronic
1122919166 14:104873025-104873047 GGCCACTTCTCATTGGTGGCTGG + Intronic
1123935205 15:25190752-25190774 GGCCACATGCCTTCTCTGGTGGG - Intergenic
1129252872 15:74318454-74318476 GGCCACTTCCCCTTTGTTCCAGG - Intronic
1132548725 16:545437-545459 GGCCACGGCCCTTCTGTGGCTGG - Intronic
1133031986 16:3015493-3015515 GGCCTCAGGCCTTTTGTTGCTGG - Exonic
1134455676 16:14393584-14393606 GGCCACTTCTCTTTTGAGACAGG + Intergenic
1136075925 16:27817219-27817241 GGCCCCATCTCTGCTGTGGCAGG + Intronic
1137034382 16:35556994-35557016 GGCACCATCCCATTTGTGGATGG + Intergenic
1137814212 16:51382972-51382994 GGCCAGAGGCCTTTTGTGTCAGG - Intergenic
1138597310 16:58035896-58035918 GGCCAGGTCCCTGGTGTGGCTGG - Intronic
1141157944 16:81610098-81610120 GGCCTCATTCCTTCTGGGGCTGG + Intronic
1141392722 16:83678151-83678173 AACCACCTGCCTTTTGTGGCTGG + Intronic
1141700277 16:85639174-85639196 GGGGACGTCCCTTTGGTGGCTGG - Intronic
1145013990 17:19385119-19385141 GGCTACACCCTCTTTGTGGCAGG - Exonic
1145171157 17:20658388-20658410 GGGCACATCCCTCCTGTGGAAGG - Intergenic
1145286742 17:21511824-21511846 GGCCAAATCCCCTTTCTTGCCGG - Intergenic
1145390869 17:22454517-22454539 GGCCAAATCCCCTTTCTTGCCGG + Intergenic
1147692408 17:42324655-42324677 GGCCGGATCCCTTTTCTGGGCGG + Intronic
1150466017 17:65393237-65393259 GGCCACATCAATTTTCTGGGTGG - Intergenic
1152500319 17:80703870-80703892 GGCCACATCCCATTTTGGTCTGG - Intronic
1156440644 18:37183952-37183974 GTCCACATCCTTTGTGGGGCAGG - Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1159905091 18:74082668-74082690 TGCCACAGGCCTCTTGTGGCAGG + Intronic
1160049515 18:75419818-75419840 GGCCTTATCCTTTCTGTGGCTGG + Intronic
1160342408 18:78101237-78101259 GGCCACATCCCTGTCCTGTCTGG + Intergenic
1165060768 19:33204268-33204290 GGCCACTGCCCTTTTGGGGAGGG + Intronic
1165426459 19:35748553-35748575 GGCCACCACCCTTCTGTGGGCGG - Exonic
1166921217 19:46230305-46230327 CCCCACATCTCTTGTGTGGCTGG - Exonic
928666527 2:33555410-33555432 GGCTACATCCTGTTTGTGCCTGG + Intronic
932656365 2:73614138-73614160 GGTTACCTCCCTTTTGTGTCTGG + Intergenic
935935064 2:108173438-108173460 GTCCACAACCCTTTGGTGGTCGG - Intergenic
941912619 2:170779386-170779408 GTCCACATACTTCTTGTGGCTGG - Intergenic
946437230 2:219665361-219665383 GGCCAGAACCCATTTCTGGCAGG - Intergenic
1170041970 20:12048682-12048704 GCTCATATCCCTTTTGTGCCAGG + Intergenic
1175904703 20:62373997-62374019 GGGCCCATCCCTGTTGTGGATGG - Intergenic
1178361997 21:31956379-31956401 GGACACATCGCTTTTATGGATGG - Intronic
1178675675 21:34629622-34629644 GGCCACCTCACTTTTATGTCAGG + Intergenic
1181807928 22:25386214-25386236 GGCCAGTTCCCTTGTGGGGCTGG - Intronic
1183736444 22:39647317-39647339 GCCCACAGCCCCTTTGTGTCAGG - Intronic
949400243 3:3658122-3658144 GGCCACAACTCTTCTGTCGCTGG + Intergenic
950370385 3:12524456-12524478 GGCCCCAGGCGTTTTGTGGCTGG + Intronic
952880392 3:37982167-37982189 GGCCACATCAGCTTGGTGGCTGG - Exonic
953240954 3:41149032-41149054 GGTCACGTTCCTTGTGTGGCTGG - Intergenic
961521630 3:127470390-127470412 GGCCACATCCTTTTTCTTGGTGG - Intergenic
961654802 3:128435346-128435368 GGCCAGATCCAGTTTCTGGCAGG + Intergenic
962291115 3:134137029-134137051 GGCCTCAGTCCTTTTGGGGCTGG + Intronic
967105564 3:186252409-186252431 GTCCCCACCCCTTTTCTGGCCGG + Intronic
967228628 3:187317115-187317137 GGCCCCTTCCCTCTTGAGGCAGG - Intergenic
973759581 4:54103886-54103908 CGCCTCCTCCCTTTCGTGGCGGG - Intronic
981143595 4:141300021-141300043 TGCTACATCCCTTATGTGTCTGG + Intergenic
988614411 5:32760476-32760498 GGCTACTTCACTTTTGTGACCGG + Intronic
990308551 5:54517581-54517603 GGCCACTGCCCTCTAGTGGCCGG - Intergenic
990363363 5:55044029-55044051 GTCCAAATCACTTATGTGGCAGG - Intergenic
992187452 5:74257786-74257808 GGCCGCCTCCCTTCTGGGGCTGG - Intergenic
993106407 5:83605680-83605702 GTCCTCATCTCTTTTGTGACTGG - Intergenic
999191035 5:149747740-149747762 TGCCACATTCCTGTTGGGGCTGG - Intronic
1003279544 6:4679506-4679528 GGCCAGACCCTTTTTGCGGCGGG - Intergenic
1004276668 6:14242584-14242606 GGCCTCCTCCTTTTTGTTGCTGG - Intergenic
1006333123 6:33406218-33406240 GGCCACAGCCCGATTCTGGCGGG - Exonic
1008047808 6:46869335-46869357 GTGCACTTCACTTTTGTGGCTGG + Intronic
1008589255 6:52976676-52976698 GGCCACACCTCTGTTGGGGCAGG + Intergenic
1010464514 6:76151270-76151292 TGCCACATCTCTTCTGAGGCAGG + Intergenic
1016833019 6:148451864-148451886 CTCCACATCCTGTTTGTGGCGGG + Intronic
1017882646 6:158572507-158572529 GGCCACACCCCTTTTGTCGATGG + Intronic
1018803197 6:167239007-167239029 GGAAACAACCCTTTTGTGCCGGG - Intergenic
1019120434 6:169799590-169799612 GGCCACGTCCCTACTGGGGCAGG - Intergenic
1019353997 7:569597-569619 ACCCACATCCCTCTTGTTGCAGG - Intronic
1021337061 7:19416705-19416727 GTTCACCTCCCTTTAGTGGCAGG + Intergenic
1022876657 7:34540019-34540041 GGTCTCATTCCTTTTGTGGCTGG + Intergenic
1028955800 7:96688162-96688184 TGCCACATCACTTTTGTGAATGG - Exonic
1033570529 7:142624187-142624209 TGCCACAGCCCTTTGGTGCCAGG + Intergenic
1034262698 7:149766545-149766567 GTTCACATCCCTTTGGTGGCTGG + Intronic
1038700265 8:29843156-29843178 GGGTCCATCCCTTTTGAGGCAGG + Intergenic
1039515518 8:38129578-38129600 GTCCACATCTCTTTTTTGGGGGG - Intronic
1039596569 8:38795512-38795534 GGCCACATCCATTTTGTAGGTGG - Intronic
1040388889 8:46933094-46933116 GGCCATGTCCCGTATGTGGCTGG - Intergenic
1042201171 8:66280401-66280423 GCTCACGTCCCTGTTGTGGCTGG + Intergenic
1043463527 8:80484309-80484331 AGCCAAAATCCTTTTGTGGCAGG + Intergenic
1047422498 8:124718633-124718655 GGAGACCTCCCTTTTGAGGCCGG - Intronic
1049185089 8:141246315-141246337 GGCCACATACCTCCTGCGGCCGG + Intronic
1049671908 8:143873683-143873705 AGCCACAGCCCTTTTGGAGCAGG - Intronic
1049726762 8:144150157-144150179 AGCCATATACTTTTTGTGGCCGG + Intronic
1055162849 9:73152551-73152573 GGCCACATTCCTTTTCTTGTAGG + Intronic
1055374550 9:75634797-75634819 GGTTACTTCCCTTTTGGGGCGGG + Intergenic
1056785517 9:89590161-89590183 GGCCTCATCTCTTTGGTGGGGGG - Intergenic
1057778987 9:98034704-98034726 GGCCTCATCCCTAGTTTGGCTGG - Intergenic
1061909576 9:133715621-133715643 GGCCACAGCCCTTCTGTGTCGGG + Intronic
1062381146 9:136287238-136287260 GGCCAGTTTCATTTTGTGGCTGG - Intronic
1189105738 X:38233505-38233527 GGCCACAACACTTCTGAGGCAGG + Intronic
1189167945 X:38879974-38879996 GCCCAGATCCCCTTTTTGGCAGG - Intergenic
1194545725 X:95231213-95231235 GGCCTCATCCAGTTTGTGGAGGG - Intergenic
1195744094 X:108096822-108096844 GGTCTCTTCTCTTTTGTGGCTGG + Intronic
1199782525 X:151075635-151075657 GGCCAGATGACTTTTGTGACTGG - Intergenic
1200150751 X:153950248-153950270 AGCCACCTCACTTGTGTGGCCGG + Exonic