ID: 1122717844

View in Genome Browser
Species Human (GRCh38)
Location 14:103706114-103706136
Sequence GGTCTCCTGAGCCTCCGTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122717844_1122717856 28 Left 1122717844 14:103706114-103706136 CCGACACGGAGGCTCAGGAGACC 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1122717856 14:103706165-103706187 AGGCAGGCACAGCACACCCTGGG 0: 1
1: 0
2: 2
3: 30
4: 305
1122717844_1122717853 12 Left 1122717844 14:103706114-103706136 CCGACACGGAGGCTCAGGAGACC 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1122717853 14:103706149-103706171 CCCAGCACTGAAGCTCAGGCAGG 0: 1
1: 0
2: 6
3: 43
4: 377
1122717844_1122717855 27 Left 1122717844 14:103706114-103706136 CCGACACGGAGGCTCAGGAGACC 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1122717855 14:103706164-103706186 CAGGCAGGCACAGCACACCCTGG 0: 1
1: 0
2: 0
3: 39
4: 380
1122717844_1122717850 8 Left 1122717844 14:103706114-103706136 CCGACACGGAGGCTCAGGAGACC 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1122717850 14:103706145-103706167 TCCACCCAGCACTGAAGCTCAGG 0: 1
1: 0
2: 1
3: 22
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122717844 Original CRISPR GGTCTCCTGAGCCTCCGTGT CGG (reversed) Intronic
901081277 1:6585657-6585679 GGTCAGCTGGGCCTCCCTGTCGG + Intronic
901129178 1:6951600-6951622 GGTCTCCTGAGTGTCTGTGGGGG - Intronic
902133657 1:14285447-14285469 AGGCTCCTGAGCCTCAGTCTTGG - Intergenic
902932403 1:19740799-19740821 GGCCTCCTGGGCCACCATGTTGG + Exonic
905885228 1:41488196-41488218 AGTCTCCTGGGCCTCCTTCTGGG - Intergenic
907936691 1:59048147-59048169 GGTCTCCTGTGGCTCCCTGTTGG + Intergenic
908445037 1:64191866-64191888 GGTCACCTCAGCCTACGTGTGGG - Intergenic
914883981 1:151570082-151570104 GGGCTCTTGAGACTCCGTGCAGG + Intronic
915348849 1:155212282-155212304 GCTTTCCTGAGCCTGTGTGTGGG - Intronic
915352041 1:155232908-155232930 GCTCTCCTGAGTCTCTGTGTGGG - Intergenic
916208196 1:162335673-162335695 GTTCTCCGGAGCCCTCGTGTTGG + Intronic
918042551 1:180922035-180922057 GGGCTCCTGAGCCTCCGAAGTGG - Intronic
922961181 1:229646953-229646975 ATTTTCCTGAGCATCCGTGTTGG + Intronic
1063298329 10:4828168-4828190 GCTCTCCTGACCTCCCGTGTGGG - Intronic
1067338455 10:45382427-45382449 GGTCTCCTGAGCCTTTGTTCTGG - Intronic
1074507715 10:114086221-114086243 GGTATCCAGGGCCTCCGTGGGGG + Intergenic
1076444041 10:130499887-130499909 GGTATCCTGAGGCTCTGTCTGGG + Intergenic
1077035865 11:494216-494238 GGGCTCCTGAGGCTCCGGGGTGG + Intergenic
1077368067 11:2169276-2169298 GGTCACCTGAGCCACTGTGCTGG + Intronic
1077394900 11:2315951-2315973 GCTGTCCTGAGCGTCCATGTTGG - Intronic
1077724368 11:4659461-4659483 GGTCTCCTGGGCCTTTTTGTTGG - Intergenic
1084947935 11:72648915-72648937 GGCCACCTGTGCCTCTGTGTAGG - Intronic
1085296690 11:75435388-75435410 GGGCTCCACAGCCTCCTTGTGGG - Exonic
1089374777 11:117986498-117986520 GCGCTCCTCAGCCTCCGTCTTGG + Exonic
1092790622 12:12067868-12067890 GCTCTCCTCAGCTTCCGTGTGGG + Intronic
1103909049 12:124341968-124341990 GTTCTCCAGCGCCGCCGTGTCGG + Exonic
1104648980 12:130517487-130517509 GGTTGCCTGAGCCTCCATGATGG - Intronic
1109519504 13:63489789-63489811 GGACTGCTGAGCCACAGTGTGGG - Intergenic
1113616209 13:111682416-111682438 GGTCTCCTGGGTCTCCGTGAAGG + Intergenic
1113621677 13:111767309-111767331 GGTCTCCTGGGTCTCCGTGAAGG + Intergenic
1113795106 13:113052324-113052346 TGCCTCATGAGGCTCCGTGTGGG + Intronic
1119769964 14:77214405-77214427 GGTCTCCTCACCCTCCGACTGGG + Intronic
1119823228 14:77636573-77636595 GGTCTCCTGACACTCCTGGTTGG + Intergenic
1122614846 14:103010198-103010220 GGTCACCTGAGCCTGGGTGGTGG + Intronic
1122717844 14:103706114-103706136 GGTCTCCTGAGCCTCCGTGTCGG - Intronic
1123148984 14:106163471-106163493 GGTGTCCTGAGCTTCCCTGCAGG + Intergenic
1202947478 14_KI270726v1_random:41920-41942 GGTCCCCTCAGCCTCCCTGCAGG - Intergenic
1123405591 15:20017994-20018016 TGTCTCCTCAGCCACCCTGTGGG + Intergenic
1123514921 15:21024642-21024664 TGTCTCCTCAGCCACCCTGTGGG + Intergenic
1127789878 15:62390407-62390429 GGGCGCCTGAGCCTCGGTGGCGG + Intergenic
1129850602 15:78791496-78791518 CCTCTCCTGAGCCTCAGTTTGGG + Intronic
1130969153 15:88718632-88718654 GGCTTCCTGAGCCTCAGTTTTGG - Intergenic
1131464471 15:92644513-92644535 GGTCTCCCCAGCCTCTGTGTTGG - Intronic
1131679920 15:94710548-94710570 GGTCTCCTGAGCCCAGGAGTTGG - Intergenic
1132648123 16:1008330-1008352 GTTGTCCTGAGCCTCCTAGTTGG - Intergenic
1133682061 16:8129048-8129070 GATCTCCTGAGCCTGTGTCTTGG - Intergenic
1135507511 16:23051630-23051652 CTTCTCTTGAGCCTGCGTGTTGG - Intergenic
1135764933 16:25169330-25169352 AGGCTGCTGAGCCTCCATGTGGG + Intronic
1136681238 16:31964109-31964131 GGTGTCCTGAGCTTCCCTGCAGG - Intergenic
1136781551 16:32905621-32905643 GGTGTCCTGAGCTTCCCTGCAGG - Intergenic
1138488701 16:57363620-57363642 GGGCTCCTGAGCCTTCCTGGAGG - Exonic
1139429865 16:66905348-66905370 TGCCTCCTGATCCTCCGTGCTGG + Intergenic
1139851163 16:69952180-69952202 GGCCTCCTGAGCCGCCCTCTGGG - Intronic
1139880141 16:70175092-70175114 GGCCTCCTGAGCCGCCCTCTGGG - Intronic
1140372368 16:74420425-74420447 GGCCTCCTGAGCCGCCCTCTGGG + Intronic
1142238789 16:88935744-88935766 GGTGTCCTGAGGCTCAGTGGTGG - Intronic
1142417957 16:89953413-89953435 AGTGTTCTGAGCCTCCGGGTGGG + Intronic
1142660537 17:1426118-1426140 GGTCACCTGAGCCTCCTGGGAGG + Intronic
1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG + Exonic
1145238963 17:21228450-21228472 GGTGTCCTGAGCCTCAATGCAGG - Intergenic
1146358960 17:32159086-32159108 GGGCTCCTGAGACACGGTGTGGG - Intronic
1147118714 17:38322344-38322366 GGTCTCCTAAGCCACTCTGTCGG + Intronic
1147844026 17:43392447-43392469 GGGCTCCTCTGCCTCCCTGTGGG - Intergenic
1147969381 17:44211417-44211439 GGCCTCCAGAGCCTGGGTGTGGG + Intronic
1147978893 17:44262801-44262823 GGTCCCCAGAGCCTCCAGGTGGG + Intronic
1149577867 17:57726905-57726927 GGTCTCCTGAGCCTGGGGTTTGG + Intergenic
1151814294 17:76463629-76463651 GGTCATCGGAGCCTCCCTGTTGG + Intronic
1153892835 18:9534199-9534221 AGTCTCCCGAGTCTCCCTGTGGG + Intronic
1159927398 18:74281530-74281552 AGTCTGCTGAGCCACTGTGTTGG + Intronic
1160123167 18:76148112-76148134 GCTCTCCTGGGCCACCCTGTGGG - Intergenic
1160317207 18:77859126-77859148 GCTCACCTGAGCCTCCTTGATGG - Intergenic
1160495455 18:79371752-79371774 TGTCCCCTGAGCTTCCGTGAGGG + Intronic
1161002302 19:1916861-1916883 GGCCTGCTGAGCCTGCATGTTGG + Intronic
1161168824 19:2802900-2802922 GGACTCCTGAGGGTCCATGTGGG - Intronic
1161250602 19:3278055-3278077 GGCCGCCTGCGCCTCCGTGTGGG - Exonic
1161590281 19:5126391-5126413 CCTCTCCTGAGCCTCCGGGGAGG + Intronic
1163148364 19:15397410-15397432 GGTCTCCTGACCTTCCCTGGGGG + Intronic
1163229792 19:15993395-15993417 GTTCTCCTGAACCCCCGTCTTGG - Intergenic
1163430912 19:17267037-17267059 GCTGGCCTGAGCCTCCATGTGGG - Intronic
1165363278 19:35349939-35349961 GGTCACCTGAGCCTCCCAGGAGG - Intergenic
1168482556 19:56734119-56734141 GGTGACATGAGCCTCTGTGTGGG + Intergenic
924995502 2:357115-357137 GGTCTTTTGAGCATTCGTGTGGG + Intergenic
932297941 2:70642347-70642369 GGTCTCCTGAGGTACTGTGTGGG - Intronic
932461687 2:71885986-71886008 GGTCTTCACAGCCTCCATGTGGG - Intergenic
935354687 2:102187519-102187541 GGTGTCCAGAGCCCCCGTGAGGG - Intronic
937826492 2:126373017-126373039 GGTCACCTGAGCGTAGGTGTGGG + Intergenic
938163288 2:129005384-129005406 GGTCTTCAGAGACTTCGTGTTGG - Intergenic
941528637 2:166637191-166637213 GGTCACCAGAGCCTCCATATGGG - Intergenic
945102901 2:206279000-206279022 GCTCTCTTGAGCCTATGTGTTGG + Intronic
945342012 2:208667731-208667753 GGTCTCCTTTGCCTCTGTGGAGG - Intronic
1168837927 20:890207-890229 TGTTACCTGAGCCTCCATGTCGG + Exonic
1169140455 20:3224611-3224633 AGCCTCCTGAGCCTCCTTGTGGG + Intergenic
1172453742 20:35049085-35049107 TCTGTCCTGAGCCTCCATGTTGG - Intronic
1172794412 20:37527306-37527328 GGTCTCCTGAGGCTCCGCTTCGG - Intronic
1173133986 20:40423051-40423073 TGACTCCTGAGCCTCAGTGAAGG + Intergenic
1174309143 20:49636970-49636992 GGTGTCCTGAGCTTCTGTCTGGG - Intronic
1178133621 21:29601368-29601390 GGACTTCTCAGCCTCCATGTTGG + Intronic
1182090535 22:27591589-27591611 GCTGTCCTGAGCCTCAGAGTGGG + Intergenic
1183705356 22:39472248-39472270 GGACTCCTGAGCCCCCTTGCAGG + Intronic
950425175 3:12921234-12921256 GGGCTCCTGAGCCTCAGTCCCGG - Intronic
953622205 3:44543105-44543127 GGTCTCCTGCCCCTCACTGTAGG - Intergenic
954248123 3:49347713-49347735 GGTCTCCTGAGCATCCTTTGTGG - Intergenic
954577064 3:51682303-51682325 GATCTCCTGTGCCTCTGGGTGGG + Intronic
959240312 3:103783795-103783817 AGTCTCCTTAGCCCCCGTATTGG + Intergenic
960709303 3:120511386-120511408 GGTCGCCTGAGCTTCCTAGTTGG - Intergenic
963827659 3:149971487-149971509 GGAATCTTGAGCCTCGGTGTCGG + Intronic
969487745 4:7481680-7481702 GGTCTCCTGAGCCTCGGTGGTGG + Intronic
970555314 4:17225745-17225767 GCTCTGCTGAGACTCCATGTAGG + Intergenic
979877590 4:125912827-125912849 GGTCTGCTGTGCCTCTGGGTAGG - Intergenic
982778697 4:159467785-159467807 TGTCTTCTGAGACACCGTGTGGG + Intergenic
985702256 5:1380623-1380645 CGCTTCCTGGGCCTCCGTGTCGG - Intergenic
985966177 5:3340316-3340338 GGACTCCTGTGCCACCGTGAGGG - Intergenic
989620531 5:43379675-43379697 GGTGTCCTGGGCCTCCCTGCTGG - Exonic
990539301 5:56756754-56756776 TGTCTCCTCAGCCTCTGTGGAGG + Intergenic
993098762 5:83511089-83511111 GGGCTACTGAGCCTCCATCTGGG + Intronic
995835441 5:116395799-116395821 AGCCTCCTGAGCCTCCTTCTAGG + Intronic
995841759 5:116448610-116448632 GGCCACCGGAGCCTCCGTCTGGG + Intronic
1006163777 6:32052938-32052960 GGGCTCCGGGGCCTCCGTGCTGG + Intronic
1006443514 6:34066212-34066234 GGTCTCCTGTGCCCACGTGCCGG - Intronic
1006574714 6:35036450-35036472 GGTCTCGTGAGACTCTGAGTAGG - Intronic
1006801020 6:36759694-36759716 GGTCCACGGAGCCTCCCTGTGGG - Intronic
1011531163 6:88322562-88322584 GCTTTGCTGAGCCTCTGTGTAGG - Intergenic
1018568674 6:165184379-165184401 GTTGTCCTGAGCCTCCGCGATGG - Intergenic
1018919211 6:168159736-168159758 GCTCTCCTGACACTCCGTGCAGG - Intergenic
1023828282 7:44024402-44024424 GGTCTCCTGAGCCTAAATGCAGG - Intergenic
1024839842 7:53573718-53573740 GCTCACCTGAGCCTCCCTGGTGG + Intergenic
1029283473 7:99451145-99451167 GGTTTCCTGAGCCTCCACATGGG - Intronic
1029774525 7:102676917-102676939 GGTCTCCTGAGCCTAAATGCAGG - Intergenic
1033225627 7:139559984-139560006 GGTCTTCTGTGCCTCTGGGTTGG - Intergenic
1035436955 7:158866455-158866477 GGTCTCCTGGGTCTCCTGGTTGG + Intronic
1037661337 8:20929491-20929513 GGTCGCCTGAGCCACCGAATGGG - Intergenic
1039687706 8:39823636-39823658 GATCTCCTGTGCCTCTGTCTTGG + Intronic
1040482921 8:47842451-47842473 GCTCTCCTGAGGCTCTGTATAGG - Intronic
1045341654 8:101260389-101260411 GGTCACCTGAGCCCCAGTCTGGG - Intergenic
1045715735 8:105042396-105042418 GGTCACTTGAGCCTAGGTGTTGG - Intronic
1045825528 8:106392983-106393005 GTTCTCCAGATCCCCCGTGTGGG - Intronic
1047960594 8:130008955-130008977 GGTCTACAGAGCCTCAGTGCTGG - Intronic
1049599313 8:143499729-143499751 GGTCCCCAGGGCCTCCGTGGAGG - Intronic
1049683492 8:143930152-143930174 GGCCTCCTGGGCCTCCTGGTTGG + Exonic
1050982999 9:12043693-12043715 GGTCTCCTGAGCCTCTGCTGTGG + Intergenic
1057208846 9:93188706-93188728 GGTAGCCTGGGGCTCCGTGTCGG + Intronic
1057432573 9:95007358-95007380 GGTCTCCTGAGAATCGGGGTGGG + Intronic
1062103780 9:134741762-134741784 GGCCTCCTGTGCCTCTGTCTGGG + Intronic
1062620166 9:137417018-137417040 GATCTCCTCGGCCTCCCTGTGGG + Intronic
1187832023 X:23391941-23391963 GATCTCTTGAGCCTCGGAGTTGG - Intronic
1188628683 X:32322474-32322496 GATCTCCTGAGCCTAGGAGTTGG + Intronic
1193284984 X:79701747-79701769 GGTCTCCTGATTCTCTGTCTAGG + Intergenic
1197168305 X:123403629-123403651 AGTTTCCTGAGCTTCCCTGTTGG - Intronic