ID: 1122718828

View in Genome Browser
Species Human (GRCh38)
Location 14:103710924-103710946
Sequence CAGGGTAGGCAAAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1046
Summary {0: 1, 1: 0, 2: 2, 3: 91, 4: 952}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122718816_1122718828 9 Left 1122718816 14:103710892-103710914 CCCATAGTACATCCCGCCCTCGG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG 0: 1
1: 0
2: 2
3: 91
4: 952
1122718815_1122718828 18 Left 1122718815 14:103710883-103710905 CCTGAAAATCCCATAGTACATCC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG 0: 1
1: 0
2: 2
3: 91
4: 952
1122718824_1122718828 -8 Left 1122718824 14:103710909-103710931 CCTCGGTTTAATAATCAGGGTAG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG 0: 1
1: 0
2: 2
3: 91
4: 952
1122718823_1122718828 -7 Left 1122718823 14:103710908-103710930 CCCTCGGTTTAATAATCAGGGTA 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG 0: 1
1: 0
2: 2
3: 91
4: 952
1122718820_1122718828 -4 Left 1122718820 14:103710905-103710927 CCGCCCTCGGTTTAATAATCAGG 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG 0: 1
1: 0
2: 2
3: 91
4: 952
1122718818_1122718828 8 Left 1122718818 14:103710893-103710915 CCATAGTACATCCCGCCCTCGGT 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG 0: 1
1: 0
2: 2
3: 91
4: 952
1122718819_1122718828 -3 Left 1122718819 14:103710904-103710926 CCCGCCCTCGGTTTAATAATCAG 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG 0: 1
1: 0
2: 2
3: 91
4: 952

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122718828 Original CRISPR CAGGGTAGGCAAAGGAAGGA AGG Intronic
900142258 1:1143604-1143626 CAGGGGATGCCCAGGAAGGACGG - Intergenic
900295847 1:1949059-1949081 GAGGGAAAGGAAAGGAAGGAAGG - Intronic
900858759 1:5208355-5208377 CAGGGTAGGCTAAGCTATGATGG - Intergenic
900979202 1:6036678-6036700 CTGGGTAGCCACAGGAGGGAAGG + Intronic
901641701 1:10695905-10695927 CAGGGTAGGTGAAGAAGGGACGG - Intronic
902184833 1:14717431-14717453 CAAGCTGGGAAAAGGAAGGAAGG - Intronic
902283007 1:15388245-15388267 CTGGGGAGGGAAGGGAAGGAGGG - Intronic
902283025 1:15388290-15388312 CTGGGGAGGGAAGGGAAGGAGGG - Intronic
902623272 1:17662681-17662703 CAGGGTATGGTAGGGAAGGATGG + Intronic
902632973 1:17716695-17716717 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
902849553 1:19143153-19143175 AAGGGAAAGGAAAGGAAGGAAGG + Intronic
903138426 1:21324318-21324340 CTGGGTGGGCAGAGGAAGCAGGG + Intronic
903674219 1:25054313-25054335 AAGGGAAGGAAAAGGAAGGGAGG - Intergenic
903748198 1:25602642-25602664 CAGGGAAGGCAAAGAAGGGAAGG + Intergenic
903823545 1:26123582-26123604 CAGGGCAGGCAAAGTGAGGGTGG - Exonic
904454436 1:30638866-30638888 CAGGTTTGGAAAAGGGAGGAGGG + Intergenic
904499755 1:30907311-30907333 CAGGGATGGCAGAGAAAGGAAGG - Intronic
904916623 1:33975109-33975131 CAGGCTAGGTGTAGGAAGGAAGG + Intronic
905166879 1:36088216-36088238 TTGGGTGGGCAATGGAAGGAGGG + Exonic
905223640 1:36465901-36465923 GAAGGAAGGGAAAGGAAGGAAGG + Intergenic
905354679 1:37373120-37373142 CTGGGGAGGCAAAGGGAGAAAGG + Intergenic
906090697 1:43176990-43177012 GAGGGGAGGCAAAGAAAGAATGG + Intronic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
906692600 1:47802411-47802433 CAGGGAAGGGAAGGGAAGGGAGG + Intronic
907208930 1:52801208-52801230 CAGGGAAGGCTGAGGAGGGAGGG + Intronic
907519198 1:55012106-55012128 AAGGGTGGGCAAGGGAAGGCAGG + Intergenic
907758135 1:57330968-57330990 CAGGGTCAGGGAAGGAAGGATGG - Intronic
907778157 1:57539009-57539031 CAAGGTTCTCAAAGGAAGGAAGG - Intronic
907907724 1:58799650-58799672 CAAGGAAGGGAAATGAAGGAGGG - Intergenic
908016670 1:59846516-59846538 GAAGGAAGGAAAAGGAAGGAAGG - Intronic
908082826 1:60598681-60598703 GAGGGGAGGGAAAGGAAGGAAGG + Intergenic
908357225 1:63334421-63334443 GAGGGAAGGGAAGGGAAGGAAGG - Intergenic
908678328 1:66630995-66631017 AAGGGAAAGGAAAGGAAGGAAGG + Intronic
908678333 1:66631014-66631036 AAGGGAAAGGAAAGGAAGGAAGG + Intronic
909345334 1:74578630-74578652 AAGGGAAAGGAAAGGAAGGAAGG - Intronic
909426675 1:75533489-75533511 CAGGGAAGGCAACGAAAAGAAGG + Intronic
909956291 1:81782911-81782933 CAGAGTAGGGAAGGGATGGAAGG + Intronic
910054011 1:83009844-83009866 CAGAGAAAGGAAAGGAAGGATGG - Intergenic
910502467 1:87908717-87908739 CAGTTTAGGAGAAGGAAGGAGGG + Intergenic
910578902 1:88799459-88799481 CAGGGTAGGACAGGGAAGGAAGG - Intronic
911052176 1:93680943-93680965 GAGGGAAGGCAAAGGAAGGGAGG - Intronic
912355121 1:109048505-109048527 AAGGGAAAGAAAAGGAAGGAAGG + Intergenic
913481953 1:119297030-119297052 CAGGATAGGATAAGAAAGGATGG - Intergenic
914240261 1:145848415-145848437 CAGGGCCAGCAAAGGAAGAATGG + Exonic
914353254 1:146858436-146858458 CAGGGTAGGGAGAATAAGGAAGG + Intergenic
914675557 1:149904940-149904962 CAGGGCAGGGAGGGGAAGGAAGG + Exonic
915100372 1:153495039-153495061 GAGGGCAGGCAGAGGAAGGAGGG - Intergenic
915488892 1:156240812-156240834 CAGGGCAGCCAAAGGCAGGATGG + Intronic
915507115 1:156364855-156364877 CAGGGTAGGAAGAGACAGGATGG - Intronic
915819988 1:159012771-159012793 CTGGGGCGGCAAAGGAAGGAAGG + Intronic
916869866 1:168901903-168901925 AAGGGAAGGAAGAGGAAGGAAGG + Intergenic
916892875 1:169130124-169130146 AAGGGTAGGCAGAGGAAGAGGGG + Intronic
917535700 1:175872908-175872930 CAGGGTCGGCAACTGCAGGACGG + Intergenic
918109134 1:181440545-181440567 CAGGGTAGGCAGAGGCAGAAAGG + Intronic
918241077 1:182620885-182620907 GGAAGTAGGCAAAGGAAGGAAGG + Intergenic
918807746 1:189071323-189071345 CAGGGGAAGCAAAGGGAGTAGGG + Intergenic
919122454 1:193358191-193358213 TAGGGTGCGGAAAGGAAGGAGGG + Intergenic
919741875 1:200985806-200985828 AAGGGAAGGGAAAGGAAGGGAGG - Intronic
919850515 1:201669000-201669022 TAGGGTAGGAAAAGAATGGAAGG + Intronic
920192196 1:204200929-204200951 CACTGAAGGAAAAGGAAGGAAGG - Intronic
920222835 1:204416789-204416811 GAAGGGAGGGAAAGGAAGGAAGG + Intergenic
920222872 1:204416944-204416966 GAGGGAGGGAAAAGGAAGGAAGG + Intergenic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
921096908 1:211894686-211894708 CAAGGAAGGCAAGGGAAGGAGGG + Intergenic
921531699 1:216290875-216290897 GAGTGTAGGCAAGGGAAGGAAGG - Intronic
922020594 1:221700208-221700230 GAGGGAAGGAAAAGGAAGGGAGG + Intergenic
922050320 1:221983164-221983186 CACGGAAGGAAAAGGAAGAAGGG - Intergenic
922244832 1:223785982-223786004 CAGTGGAAGGAAAGGAAGGAGGG + Intronic
922575767 1:226659737-226659759 CAGGGAAGGGAAAGGAAGCTGGG + Intronic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
922934253 1:229411414-229411436 AAGGGGAGGAAAGGGAAGGAAGG - Intergenic
923358328 1:233182674-233182696 CCATGTAGGCAAAGGCAGGAGGG - Intronic
923370319 1:233304603-233304625 AAAGGGAGGGAAAGGAAGGAAGG + Intergenic
923480972 1:234383064-234383086 GAGGGAAGGGAATGGAAGGAAGG + Intronic
923615516 1:235534034-235534056 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
923678212 1:236098368-236098390 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
923784469 1:237054208-237054230 GAGGGAAGAAAAAGGAAGGAAGG - Intronic
923935697 1:238757299-238757321 ATGGGAAGGGAAAGGAAGGACGG + Intergenic
924074837 1:240323127-240323149 AAGGAAAGGAAAAGGAAGGAAGG - Intronic
924191851 1:241561739-241561761 CAAGGTAGGGAGAGAAAGGAAGG - Intronic
924212783 1:241787824-241787846 GAGGGAAGGAAAAGGAAGGGAGG - Intronic
924608817 1:245557343-245557365 CAGAGGAGGCAAAGCCAGGAGGG - Intronic
924703857 1:246482048-246482070 CTGGGAAGGCTAAGGTAGGAGGG + Intronic
924809705 1:247390215-247390237 CAGGTTAAGAAGAGGAAGGAGGG - Intergenic
1062930482 10:1349259-1349281 TTGGGTAGGTAAAGGAAGAAGGG - Intronic
1062985483 10:1764948-1764970 CAGGGTACGTTAAGGCAGGAAGG + Intergenic
1063081986 10:2776045-2776067 CAGAATAGGCGAAGGAAGCAGGG + Intergenic
1064256907 10:13750035-13750057 GAGGGAAAGGAAAGGAAGGAAGG + Intronic
1064462319 10:15546873-15546895 AAGGGAAGGGAAAGGAAGAAAGG + Intronic
1064750402 10:18522531-18522553 CAGGGGAGGCAAGGGTAGGAAGG + Intronic
1065169201 10:23010481-23010503 GAGGGGAGGGAAAGGAAGGAGGG - Intronic
1065169257 10:23010682-23010704 GGGGGAAGGGAAAGGAAGGAAGG - Intronic
1065169264 10:23010702-23010724 AAGGGGAGGGAAAGGAAGGAGGG - Intronic
1065169333 10:23010930-23010952 AAGGGAAGGGAAAGGAAGGAAGG - Intronic
1065450134 10:25848341-25848363 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1065631600 10:27686384-27686406 AAGGGAAGGGAAAGGAAGGAAGG + Intronic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1065885371 10:30072136-30072158 CAGGGAAGGGAAGGGAAGAAGGG + Intronic
1065933272 10:30497971-30497993 CAGGGAAAGCAAGGGAAGGCAGG - Intergenic
1066112604 10:32210604-32210626 CACGGTAGGAAAGGGAAGAAAGG - Intergenic
1066275617 10:33865639-33865661 CAGGGAAAAGAAAGGAAGGAAGG - Intergenic
1066502427 10:36007089-36007111 GAGGGTGGGGAAAGGGAGGAGGG - Intergenic
1067050857 10:43019472-43019494 AAAGGGAGGAAAAGGAAGGAAGG + Intergenic
1067107278 10:43374662-43374684 CAGGATAGGCAAGGGTAGGGTGG - Intronic
1067678705 10:48411830-48411852 GAGGGTGGAGAAAGGAAGGAAGG - Intronic
1068024616 10:51627866-51627888 AAGGGAAGGGAAGGGAAGGAAGG - Intronic
1068181661 10:53527480-53527502 CTGGGTCTGGAAAGGAAGGAAGG + Intergenic
1068477222 10:57543225-57543247 AAGGGAAAGGAAAGGAAGGAAGG + Intergenic
1068960788 10:62864393-62864415 AAAGATAGGGAAAGGAAGGAAGG + Intronic
1069953571 10:72036037-72036059 CAGGCTGGGGAAAGGAGGGAAGG - Intergenic
1069974118 10:72198389-72198411 AAGGGAAGGGAAGGGAAGGAAGG + Intronic
1070634505 10:78113591-78113613 AAGGGTAGGGGAAGGAAGGAAGG - Intergenic
1070877123 10:79825533-79825555 CAGCGGAGGTTAAGGAAGGAGGG + Intergenic
1071554959 10:86594501-86594523 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1071643618 10:87341577-87341599 CAGCGGAGGTTAAGGAAGGAGGG + Intergenic
1071699979 10:87921213-87921235 CAAGGCAGGCAAGGCAAGGAAGG - Intronic
1071760174 10:88594380-88594402 AAGAGTAGTTAAAGGAAGGATGG - Intronic
1073044429 10:100628522-100628544 CAGGCTGGGGCAAGGAAGGAGGG - Intergenic
1073063830 10:100746970-100746992 AAGGGAAGGCAAGGGAAGGGGGG - Intronic
1073254775 10:102143739-102143761 GAGGGTAGGTATAGGAAGAATGG + Intronic
1073491501 10:103855764-103855786 CAGGGAAGGGAAGGGAGGGAGGG + Intergenic
1073662240 10:105489228-105489250 CAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1074059361 10:109950773-109950795 CAAGTGAGGCAAAGGAAGGCTGG + Intronic
1074103968 10:110375212-110375234 CTGGGTTGGCAAGGGAGGGAAGG - Intergenic
1074116126 10:110458674-110458696 TAGGGTAGGCAATGGAAAGCGGG - Intergenic
1074388286 10:113034963-113034985 AAGGGGAGGAAAGGGAAGGAGGG - Intronic
1074514186 10:114149639-114149661 GAGGGAATGCGAAGGAAGGAAGG + Intronic
1074567865 10:114597505-114597527 AAGGGAAGGGAAAGGAAGGAAGG + Intronic
1075113709 10:119608639-119608661 AAGGGAAGGGAAAGGAAGCAAGG + Intergenic
1075485110 10:122815405-122815427 AAAGGAAGGAAAAGGAAGGAAGG - Intergenic
1075715354 10:124552142-124552164 CAGGGTGGGGAAAGGCTGGAGGG - Intronic
1075737896 10:124675268-124675290 AAAGGGAGGGAAAGGAAGGAAGG + Intronic
1077603973 11:3594666-3594688 GAGTGTAGGCAAAAGAAAGAGGG - Intergenic
1077818172 11:5708485-5708507 CAGAGTAGGGAAAGGAAAGGGGG - Intronic
1077905625 11:6530647-6530669 CAGGGAAGGCGAAGCAAGCAGGG - Intronic
1078859425 11:15233700-15233722 GAAGGGAGGTAAAGGAAGGAAGG - Intronic
1079156167 11:17949727-17949749 CAGGGGAGGTAAAGGGAGGGTGG + Intronic
1079172869 11:18112853-18112875 CCAGGAAGGCCAAGGAAGGAGGG + Intronic
1079496034 11:21045088-21045110 CAGGGCAAGTAAAGGCAGGAGGG + Intronic
1079590490 11:22177344-22177366 CAGGGTATTGAAAGGAAGGGAGG - Intergenic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079782493 11:24625358-24625380 AAGGGAAAGGAAAGGAAGGAAGG + Intronic
1080050304 11:27852132-27852154 CAGGCTAGATGAAGGAAGGAAGG - Intergenic
1080050809 11:27857136-27857158 CAGAGCTGGAAAAGGAAGGAAGG - Intergenic
1080237869 11:30092778-30092800 GAAGGAAGGGAAAGGAAGGAAGG - Intergenic
1080774125 11:35370021-35370043 CAGTGTGGGCAAAGGCATGAAGG + Intronic
1080883568 11:36345201-36345223 CAGGATAGGTAGAGGAAGAAGGG + Intronic
1080988241 11:37497427-37497449 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1081190153 11:40094207-40094229 CAGTGTAGCCAGTGGAAGGAAGG + Intergenic
1081192775 11:40124673-40124695 GTGGGGAGGCAAAGGAGGGATGG + Intronic
1081696950 11:45119260-45119282 GAGAGTAGGCAAATGAAAGAGGG + Intronic
1081785438 11:45743472-45743494 GAAGGAAGGGAAAGGAAGGAAGG + Intergenic
1081952382 11:47055365-47055387 GAGGGGAGGGGAAGGAAGGAAGG - Intronic
1081983986 11:47288437-47288459 CCGGGTAGGCTAAGGATGGAAGG + Intronic
1082611995 11:55311181-55311203 CAGAGAAGACTAAGGAAGGAGGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083041349 11:59690635-59690657 GAAGGAAGGGAAAGGAAGGAAGG - Intergenic
1083041356 11:59690661-59690683 GAAGGAAGGGAAAGGAAGGAAGG - Intergenic
1083871260 11:65489841-65489863 CAGAGTAGGGAAAGGAAGGCCGG - Intergenic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084207771 11:67606012-67606034 CTGGGAAGGCAAAGGACAGAGGG + Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084526888 11:69703548-69703570 TAAGGGTGGCAAAGGAAGGAAGG + Intronic
1084801904 11:71549477-71549499 CCTGGCAGGCAAAGGAAAGAAGG - Exonic
1084852725 11:71955896-71955918 GTGGGTAGGAAAAGGAAGGAGGG + Intronic
1084909623 11:72377695-72377717 AAGGGAAGGGGAAGGAAGGAAGG + Intronic
1084935324 11:72583796-72583818 CAGGGAAGGAGAAGCAAGGAGGG + Intronic
1085084303 11:73656487-73656509 CTGAGTGAGCAAAGGAAGGAAGG + Intronic
1085428621 11:76426785-76426807 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1085775128 11:79358676-79358698 CAAGGGAGGCAAGGGAGGGAGGG - Intronic
1085931542 11:81089298-81089320 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
1086234406 11:84610667-84610689 CAGGGAAGGAAAAGTGAGGAGGG - Intronic
1086393551 11:86390692-86390714 GTGGGTAGGAAGAGGAAGGAAGG + Intronic
1086654671 11:89338895-89338917 CAGGTTAGGACAAAGAAGGAAGG - Intronic
1086719323 11:90100882-90100904 CAGGGGACAGAAAGGAAGGATGG + Intergenic
1087870121 11:103283480-103283502 CAGGGGAAGGAACGGAAGGATGG - Intronic
1088050572 11:105509501-105509523 CAGGGTAGGAAAAGAAGGGTGGG - Intergenic
1088676281 11:112196912-112196934 AAGGGAAGGGAAGGGAAGGAAGG - Intronic
1089008844 11:115115838-115115860 GAGGGTGGGGGAAGGAAGGATGG + Intergenic
1089033106 11:115354458-115354480 CAAGGCAGGGCAAGGAAGGAGGG + Intronic
1089111699 11:116062516-116062538 CAGGGTAGGAGAGGCAAGGAAGG - Intergenic
1089554712 11:119310051-119310073 CATGGCAGGCCAGGGAAGGAGGG + Intronic
1089814644 11:121161537-121161559 AAGGGAAGGGAAGGGAAGGAGGG - Intronic
1089833287 11:121347927-121347949 CAGGGGATGTGAAGGAAGGAGGG + Intergenic
1089981262 11:122774585-122774607 AAGGGTAGGACAAGGAAGGAGGG + Intronic
1090096790 11:123750201-123750223 CAGGGGAGGCAAAGACATGAAGG - Intergenic
1090145946 11:124322766-124322788 CAGGATAGAGAATGGAAGGATGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090585980 11:128213991-128214013 CCGGTTAGGAAAAAGAAGGATGG - Intergenic
1090833692 11:130438495-130438517 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
1091566133 12:1649474-1649496 CATCGTAGGCAGAGGAGGGAGGG - Intergenic
1091633167 12:2177545-2177567 GAGGGAAGGAAAGGGAAGGAAGG - Intronic
1091644553 12:2263903-2263925 CAGGATGTGCAAAGGAAAGAGGG + Intronic
1091675776 12:2488343-2488365 CATGGTAGACAAAGAAAGCATGG + Intronic
1091776335 12:3187363-3187385 AAAGGCAGGCAGAGGAAGGAAGG - Intronic
1092416475 12:8293880-8293902 TTGGGTAGGTAAAGGAAAGAGGG + Intergenic
1092738272 12:11604708-11604730 CAGGCTAAGCAAAGGAAAAAAGG + Intergenic
1092756377 12:11767039-11767061 CAGGCTAGGAGAAAGAAGGATGG + Intronic
1092790171 12:12063921-12063943 TTGGGTAGGTAAAGGAAGAAGGG - Intronic
1092924319 12:13259767-13259789 TTGGGTAGGTAAAGGAAGGAGGG + Intergenic
1093195457 12:16125072-16125094 AAGGGAGGGGAAAGGAAGGAAGG - Intergenic
1093310798 12:17581166-17581188 GAGGGAAAGAAAAGGAAGGAAGG + Intergenic
1093387291 12:18573548-18573570 CAGGGTAGGATCTGGAAGGAAGG - Intronic
1093628717 12:21383035-21383057 CAGGTCAGGCAAAAGAAGAATGG + Intronic
1094467161 12:30765615-30765637 CAGCCTAGGGAAAGGAAGTAGGG + Intergenic
1094641639 12:32281746-32281768 CTGGGCAGCCAAAAGAAGGAGGG - Intronic
1095113077 12:38319305-38319327 CAGCATAAGCAAAGGAAGAAAGG + Intronic
1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG + Exonic
1095748402 12:45685137-45685159 TAGGGTAGGGAGTGGAAGGAAGG - Intergenic
1095866666 12:46979705-46979727 AAGGGAAGGGAAAGGAAGGGAGG + Intergenic
1095995587 12:48081005-48081027 CAGAGGAGGCAAAAGAAGGAAGG + Intronic
1097301415 12:58023123-58023145 AAGGGCATGCCAAGGAAGGATGG - Intergenic
1097488120 12:60231800-60231822 CAGTATAGAGAAAGGAAGGAAGG - Intergenic
1099274503 12:80558058-80558080 GAGGGAAGGGAAGGGAAGGAAGG - Intronic
1099283417 12:80683441-80683463 AAGGGTAGGAAATGGAAGCATGG + Intergenic
1099431339 12:82590027-82590049 CAGGTTTGTCAAAGGTAGGATGG - Intergenic
1099530153 12:83769066-83769088 AATGGGAGGAAAAGGAAGGAAGG + Intergenic
1100367086 12:93931898-93931920 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
1100549843 12:95636953-95636975 TAGGGTAGGCCATGGCAGGAGGG + Intergenic
1100777494 12:97989254-97989276 AAGGGAAGGGAAAGGAAGGAAGG + Intergenic
1100877202 12:98975025-98975047 GAAGGAAGGAAAAGGAAGGAAGG - Intronic
1101071220 12:101077885-101077907 CCGGATAAGCAAAAGAAGGAGGG - Intronic
1101743858 12:107522811-107522833 AAGGGAAGGGAAGGGAAGGAGGG + Intronic
1102312547 12:111858004-111858026 CTGGGTAGGCTGAGGTAGGAGGG - Intronic
1102513242 12:113429480-113429502 CAGGGTGGGCAGAGGAAAGTTGG - Intronic
1103138786 12:118530639-118530661 AAGGGAAGGAAAAGGAAAGAAGG + Intergenic
1103745252 12:123118498-123118520 CCTGGTAGGCAAAGCAAAGAGGG + Intronic
1104004635 12:124883394-124883416 GAGGGAAAGAAAAGGAAGGAAGG + Intergenic
1104350425 12:128040482-128040504 CTGGATCTGCAAAGGAAGGAAGG - Intergenic
1104718983 12:131034174-131034196 CAGGGTGGGCAGGGGAAGAAGGG - Intronic
1105961816 13:25348768-25348790 AAGGGTAGACAAAGAAAGCAGGG - Intronic
1106050270 13:26183422-26183444 CAGAGTGGGGAAAGAAAGGAAGG - Intronic
1107181791 13:37469847-37469869 CAAGGCAGGCAGAAGAAGGAGGG + Intergenic
1107813324 13:44220584-44220606 CAGGGTAGGCATAAGAAGAGAGG - Intergenic
1107837658 13:44424701-44424723 GAGGGAGGGAAAAGGAAGGAAGG - Intergenic
1108227279 13:48303202-48303224 CTGGTTAGGGAAAGGAAGGGAGG - Intergenic
1108436558 13:50406710-50406732 AAGGGAAGGGAAGGGAAGGAAGG - Intronic
1108735779 13:53281982-53282004 GAGGGAAGGGAAGGGAAGGAAGG - Intergenic
1109407622 13:61921949-61921971 CAGGGTGGGGAGAGGAAAGAAGG - Intergenic
1110168552 13:72472869-72472891 GAGGGAAGGAAGAGGAAGGAAGG + Intergenic
1110223518 13:73096530-73096552 CAGGGTCGGCAAAGGGACAAGGG + Intergenic
1110411449 13:75208079-75208101 CATGGGAGGCCAAGGCAGGAGGG + Intergenic
1110592952 13:77285900-77285922 AAAGGAAAGCAAAGGAAGGAAGG + Intronic
1111048316 13:82846415-82846437 AAGGGAAGGGAAAGGAAGGGAGG + Intergenic
1111653258 13:91120152-91120174 GAGGGAAAGGAAAGGAAGGAAGG + Intergenic
1111803595 13:93010019-93010041 CAGGGAAGAGAAAGGAAAGATGG + Intergenic
1112421699 13:99257075-99257097 AAGGGAAGGGAAAGGAAGGAAGG - Intronic
1112580175 13:100671700-100671722 CAGGGGAGTCACAGCAAGGAGGG - Intronic
1112727937 13:102326681-102326703 AAGGGAAGGGAAGGGAAGGAAGG + Intronic
1112752960 13:102600177-102600199 AAGGGGAGGCAAAGGATGAAAGG - Intronic
1113586256 13:111468134-111468156 CAGGGGTGGCATGGGAAGGAAGG + Intergenic
1113754760 13:112803765-112803787 GAGGGGAGGGAGAGGAAGGAGGG - Intronic
1113947354 13:114051639-114051661 CAGTGTGGGCACAGGAAGGGCGG - Intronic
1114443553 14:22770504-22770526 CAGGCTGGGCACAGGAAGGTTGG - Exonic
1114493719 14:23118818-23118840 GAGGGTAGGCAAAGGGCCGAGGG + Exonic
1114979150 14:28140618-28140640 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
1115734539 14:36310436-36310458 CAGGGTAGGTCAAGGGATGATGG - Intronic
1115909049 14:38235215-38235237 CCATGTAAGCAAAGGAAGGAGGG - Intergenic
1116252087 14:42499262-42499284 AAGGGAAGGCAAGGGAAGGAAGG - Intergenic
1116874453 14:50097198-50097220 CAGAGAAGGAAAAGGAACGAAGG + Intergenic
1117225678 14:53656114-53656136 TCTGGAAGGCAAAGGAAGGATGG - Intergenic
1117503474 14:56377143-56377165 GAGGGAAAGAAAAGGAAGGAAGG - Intergenic
1117509254 14:56432209-56432231 AAGGGAAAGGAAAGGAAGGAAGG - Intergenic
1118219311 14:63840465-63840487 GAGGGAGGGAAAAGGAAGGAAGG - Intergenic
1118333468 14:64832395-64832417 CAGAGCAGGCAAAGGAGGAAGGG - Intronic
1118360296 14:65051015-65051037 CAGGTGAGGAAAAGAAAGGAAGG + Intronic
1119629864 14:76220017-76220039 CAGGGAAGGCTATGAAAGGAGGG - Intronic
1119673729 14:76538896-76538918 AAGGGAAGGGAAAGGAAGGGAGG - Intergenic
1119758787 14:77137155-77137177 CATGGGAGGGAAAGAAAGGAAGG + Intronic
1119877220 14:78071164-78071186 CCAGGTAGGCACAGGAGGGAAGG - Intergenic
1119965040 14:78905175-78905197 CAGGCTGGGCAAAGGAAAGGAGG - Intronic
1119969135 14:78949697-78949719 CAGGGAAGGCTGAGGAGGGATGG + Intronic
1120923103 14:89772782-89772804 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
1121015454 14:90546266-90546288 AAGGGAAGGGAAAGGAAGGAAGG - Intronic
1121261562 14:92570011-92570033 CAGGGATGGCACAGGAAGGAAGG - Intronic
1121434636 14:93911010-93911032 CCGGGGAGGGACAGGAAGGATGG - Intergenic
1121467817 14:94127403-94127425 GAGGTTAGGCAAGGGAAGGATGG + Intergenic
1121497343 14:94402983-94403005 CAGGGGAAAGAAAGGAAGGAAGG - Intergenic
1121620512 14:95344580-95344602 CAGGGTGGAAACAGGAAGGAGGG + Intergenic
1121850287 14:97215598-97215620 AAGGGGAGGGAAGGGAAGGAAGG + Intergenic
1122002037 14:98666861-98666883 GAAGGAAGGAAAAGGAAGGATGG - Intergenic
1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG + Intronic
1122914593 14:104852426-104852448 CAGGGTGAGCCTAGGAAGGAAGG - Intergenic
1123050401 14:105538629-105538651 CGGGGTGGGCTAAGGAAGGTGGG + Intergenic
1123964256 15:25439145-25439167 CGGGGCCGGCGAAGGAAGGAGGG - Intergenic
1125584035 15:40807711-40807733 CAGGGCAGGGAAGGGAAGGGCGG + Exonic
1125644547 15:41261103-41261125 AAGGAAAGGAAAAGGAAGGAAGG - Intronic
1125832609 15:42727587-42727609 CAGGGAAGCCAAAGGGAGTAGGG + Intronic
1125886663 15:43234644-43234666 CAGAAGAGGCAAAGGAAGGAGGG + Intronic
1126000506 15:44205130-44205152 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1126151352 15:45526198-45526220 GAGGGAAGGGGAAGGAAGGAAGG - Intergenic
1126173402 15:45713136-45713158 GAGGGAAGGAAAAGGAAGGGAGG - Intergenic
1126173409 15:45713158-45713180 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
1126173418 15:45713192-45713214 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
1126532188 15:49723159-49723181 GAGGGCAGGCAAAGGAGGAAGGG + Intergenic
1126645042 15:50867449-50867471 CTGGATCTGCAAAGGAAGGAAGG + Intergenic
1126835767 15:52663176-52663198 CAGGGAAGGGAATGGAAGGAAGG - Intronic
1127976530 15:64001378-64001400 CGGGGTAGGAGGAGGAAGGAAGG - Intronic
1128544161 15:68556110-68556132 CGGGCCAGGCAAAGAAAGGAGGG + Intergenic
1128701938 15:69811103-69811125 CAGAGGAGGCAGGGGAAGGAAGG - Intergenic
1128705036 15:69832345-69832367 AAGGGAAGGGAAATGAAGGAAGG + Intergenic
1128705041 15:69832364-69832386 AAGGGAAGGGAAATGAAGGAAGG + Intergenic
1128705046 15:69832383-69832405 AAGGGAAGGGAAATGAAGGAAGG + Intergenic
1128705051 15:69832402-69832424 AAGGGAAGGGAAATGAAGGAAGG + Intergenic
1128705056 15:69832421-69832443 AAGGGAAGGGAAATGAAGGAAGG + Intergenic
1128916359 15:71566619-71566641 CAGGGTAGGAAAGGTAGGGATGG - Intronic
1129153626 15:73704112-73704134 CAGGGGAGGAAAAGGATGCATGG - Intronic
1129254791 15:74328100-74328122 CAGGCTGGGCAAAGAAAGAAGGG + Intronic
1129423383 15:75448068-75448090 CATGGGAGGCTAAGGTAGGAGGG + Intronic
1129426702 15:75468719-75468741 CAGGGTAGTTTAAGGAAGGCTGG + Exonic
1129608758 15:77037392-77037414 CAGAGGAGGCAAAGGAACAAGGG + Intergenic
1129834773 15:78695318-78695340 GAGGGGAGACAAAGGAAGGGAGG - Intronic
1130014969 15:80179596-80179618 CAGGGCAGGCCAAGGAGCGAGGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130168460 15:81486647-81486669 CAGGGATGGCTAAGTAAGGAGGG + Intergenic
1130868195 15:87949930-87949952 CAGAAGAGGCAGAGGAAGGAGGG - Intronic
1131010843 15:89017360-89017382 AAGGGGAGGCAAAGAGAGGAAGG - Intergenic
1131657701 15:94478863-94478885 AACCGAAGGCAAAGGAAGGAAGG - Intronic
1131963730 15:97815560-97815582 GAGAGTAGGGAAAGGAAGGATGG + Intergenic
1132184029 15:99788314-99788336 CAGAAAAGGAAAAGGAAGGAAGG - Intergenic
1132229070 15:100168510-100168532 CAGGGCAGGAAATGGAAAGATGG + Intronic
1132404107 15:101532050-101532072 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1133688282 16:8188002-8188024 AAAGGGAGGGAAAGGAAGGAAGG + Intergenic
1133853089 16:9524336-9524358 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134754038 16:16650669-16650691 AAAGGGAGGGAAAGGAAGGAAGG - Intergenic
1134892578 16:17854038-17854060 AAAGGAAGGGAAAGGAAGGAAGG + Intergenic
1134992021 16:18708375-18708397 AAAGGGAGGGAAAGGAAGGAAGG + Intergenic
1135016369 16:18927381-18927403 GAGGGAAGAAAAAGGAAGGAAGG + Intergenic
1135226119 16:20659686-20659708 CTGGATATGGAAAGGAAGGAAGG - Intronic
1135321993 16:21503207-21503229 GAGGGAAGAAAAAGGAAGGAAGG + Intergenic
1135331595 16:21564619-21564641 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
1135542600 16:23343499-23343521 GAAGGAAGGAAAAGGAAGGAAGG + Intronic
1135811187 16:25588121-25588143 AAGGGAAGGGAAAGGAAGGGAGG - Intergenic
1135892640 16:26371443-26371465 AAGGGAAGGGAAGGGAAGGAGGG + Intergenic
1135892665 16:26371553-26371575 GAAGGGAGTCAAAGGAAGGAAGG + Intergenic
1135985769 16:27182848-27182870 GAGGGAAGGCAAGAGAAGGAGGG + Intergenic
1135992799 16:27228213-27228235 CTGGGTGAGCACAGGAAGGAAGG + Intronic
1136333464 16:29596319-29596341 GAGGGAAGAAAAAGGAAGGAAGG + Intergenic
1136405797 16:30046225-30046247 CAGGCTAGGGGAAGGAAAGATGG - Intronic
1136644000 16:31592880-31592902 CAGGGTGGGGGAAGGAAGGAAGG - Intergenic
1136661609 16:31767912-31767934 GGGGGTAGGGGAAGGAAGGAAGG + Intronic
1138154036 16:54686103-54686125 AAGGGAAGGGAAGGGAAGGAGGG - Intergenic
1138473351 16:57256182-57256204 CATGGGACGCAAAGGAGGGAGGG - Exonic
1138756364 16:59490938-59490960 CAGGGGAGGGGGAGGAAGGAGGG - Intergenic
1138957670 16:61990899-61990921 GAAGGAAGGAAAAGGAAGGAGGG + Intronic
1139060032 16:63238823-63238845 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
1139144473 16:64307510-64307532 GAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1139274655 16:65716354-65716376 AAGGGGAGGGAGAGGAAGGAAGG + Intergenic
1139388817 16:66592304-66592326 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1139421581 16:66852521-66852543 GAAGGAAGGGAAAGGAAGGAAGG + Intronic
1139980770 16:70857082-70857104 CAGGGTAGGGAGAATAAGGAAGG - Intronic
1140273638 16:73488294-73488316 TATGGGTGGCAAAGGAAGGAGGG + Intergenic
1140463301 16:75159234-75159256 AAGGGAAGGGAAGGGAAGGAAGG - Intronic
1140943978 16:79749969-79749991 CACAGTGGACAAAGGAAGGATGG - Intergenic
1141373425 16:83508100-83508122 GAAGGAAGGAAAAGGAAGGAAGG + Intronic
1141734617 16:85844070-85844092 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1142135264 16:88449107-88449129 CAGGCCAGGCAACGGAGGGAAGG + Intergenic
1142395477 16:89828988-89829010 CCGGGGAGGGAGAGGAAGGAGGG - Intronic
1143035282 17:3991889-3991911 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
1143404724 17:6669717-6669739 GATGGAAGGCAAAGGAAGAAGGG - Intergenic
1143514227 17:7411395-7411417 CAGTGTGGGCAAAGCAGGGAAGG - Intronic
1144620823 17:16817444-16817466 CAGTGCAGGCAAAGCAACGAGGG - Intergenic
1144871012 17:18370986-18371008 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
1144999031 17:19290533-19290555 GAGGGTGGGTAAGGGAAGGAAGG + Intronic
1145756030 17:27390601-27390623 CAGGAAAGGCCAAGGCAGGATGG - Intergenic
1145868838 17:28257323-28257345 AAGGGGAGGAAAAGAAAGGAGGG + Intergenic
1145901464 17:28493194-28493216 CAGAGAAGGCAGAGGAGGGAAGG + Intronic
1146274305 17:31506532-31506554 GAGGGTAGGAGAAGGGAGGACGG - Intronic
1146656785 17:34639161-34639183 CAGGGTGGGCAAATGCAGAAGGG + Exonic
1146728586 17:35175115-35175137 AAGGGAAAGGAAAGGAAGGAAGG + Intronic
1147527074 17:41235826-41235848 CGAGGGAGGGAAAGGAAGGAAGG + Intronic
1147572212 17:41578347-41578369 CAGTGCAGGCAAAGCAACGAGGG - Intergenic
1147770329 17:42863676-42863698 AAGGGAAGGCAAGGGAAGGAAGG - Intergenic
1148071068 17:44908888-44908910 CAGGAAAGAGAAAGGAAGGAAGG + Intronic
1148552717 17:48560112-48560134 CAGAGAAGGCAGAGGAAGGGAGG + Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148713638 17:49700009-49700031 GAGGGTGGAGAAAGGAAGGAAGG + Intergenic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1150583799 17:66499276-66499298 CAGGGTAGGGAAACCAAGAAGGG + Intronic
1150593859 17:66586267-66586289 CAAGTTAGGTAAAGGAAAGAAGG - Intronic
1150789657 17:68193118-68193140 AAGGGTAGGGAAAAGGAGGATGG - Intergenic
1151200164 17:72462063-72462085 AAGGGAAGGGAGAGGAAGGAAGG - Intergenic
1151310509 17:73289759-73289781 GAGGGGAAGGAAAGGAAGGAAGG + Intronic
1151331345 17:73411055-73411077 GGGGGGAGGCAGAGGAAGGAAGG - Intronic
1151719238 17:75846195-75846217 CAGGACAGGGAAGGGAAGGAAGG + Exonic
1151814004 17:76462145-76462167 CTGGGTCGGCTAAGGGAGGAAGG + Intronic
1152045247 17:77930841-77930863 CGGGGAAGGCAAAGTAGGGATGG - Intergenic
1152732683 17:81980341-81980363 CAGGGTGGGCAATGCCAGGAGGG - Intronic
1152807221 17:82361857-82361879 CTGGAAAGGCAAAGGAAGGGAGG - Intronic
1152940398 17:83169198-83169220 AAGGGAAGGGAAAGAAAGGAAGG - Intergenic
1153118415 18:1689801-1689823 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1154167176 18:12024686-12024708 CAAGGGAGGAAAAGGAAAGAAGG - Intronic
1155061993 18:22237002-22237024 AAGGGTAGGATAAGGGAGGAGGG + Intergenic
1156706461 18:39888828-39888850 CAGCTTAGGCAAAGAAGGGAAGG - Intergenic
1156961630 18:43039012-43039034 CAGTGAAGGAAAAGGTAGGAAGG - Intronic
1157043668 18:44069034-44069056 CAAGGAAAGAAAAGGAAGGAAGG - Intergenic
1157300340 18:46474500-46474522 CAGGGCAGGTAAAGGATGGCCGG + Intergenic
1157447327 18:47755211-47755233 TAGGGTAGGACAAGGAAGGGAGG + Intergenic
1157643392 18:49241713-49241735 CAGGGTAGGGAGAAAAAGGAGGG + Intronic
1158314378 18:56194516-56194538 AAGGGAAGGGAAGGGAAGGAGGG - Intergenic
1159680379 18:71342998-71343020 GAGGGGAGGAAAAGGAAGGAAGG - Intergenic
1159719752 18:71873613-71873635 AAGGGAAGGGAAAGGAAGGGAGG - Intergenic
1160371740 18:78377877-78377899 CAGGGAGGGAGAAGGAAGGATGG - Intergenic
1160537247 18:79601261-79601283 CTGGATCTGCAAAGGAAGGAAGG - Intergenic
1160560239 18:79751269-79751291 CAGGGCAGGCCAGGGAAGGAGGG + Intronic
1161095407 19:2387541-2387563 AAGGGAAGGGAAAGGAAGGGAGG + Intergenic
1161427750 19:4213342-4213364 AAGGGAAGGAAAACGAAGGAAGG - Intronic
1161643367 19:5437303-5437325 GAGGGTAGGCAGAGGCAGGAGGG + Intergenic
1162029589 19:7911632-7911654 CTGGGGAGGCAATGGCAGGAGGG + Intronic
1162096999 19:8316210-8316232 CTGGGGAGGCCAAGGAAGGAGGG + Intronic
1162153407 19:8660992-8661014 AAGGGAAGGGAAAGGAAGGAAGG - Intergenic
1162310053 19:9900937-9900959 GAGGGAAGGGGAAGGAAGGAAGG + Intronic
1163000219 19:14362489-14362511 CGGGGAAGGAGAAGGAAGGAAGG + Intergenic
1163296435 19:16415830-16415852 CCGGGCAGGCCAAGGATGGAGGG - Intronic
1163600911 19:18248436-18248458 CGGGGAGGGCAGAGGAAGGAGGG + Intronic
1164030114 19:21396277-21396299 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
1164292774 19:23882249-23882271 CGGAGTAGGAAAAGGAGGGAAGG + Intergenic
1164420032 19:28081659-28081681 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
1164428949 19:28170062-28170084 CAGGGAAGGGGAGGGAAGGATGG - Intergenic
1164493544 19:28736497-28736519 AAGAGAATGCAAAGGAAGGAAGG - Intergenic
1164714812 19:30383905-30383927 AAGGGAAGGGAAAGGAAGAAAGG - Intronic
1164715259 19:30386127-30386149 CAGCGTAGGCAAAGGGCTGAGGG - Intronic
1164897245 19:31887702-31887724 GAGGGTAGGCAAAGGGAGAGAGG + Intergenic
1165043033 19:33082330-33082352 TAGGGAAGGCAGAGGAAGAATGG + Intronic
1165085268 19:33341173-33341195 AAGGAAAGGAAAAGGAAGGAAGG + Intergenic
1165294428 19:34915315-34915337 GAAGGGAGGGAAAGGAAGGAAGG + Intergenic
1165419535 19:35716101-35716123 CAGAGAAGGCAAAGGAGGGCAGG - Intronic
1165423996 19:35735752-35735774 CAGCGAAGGCAAAAGAAGAATGG - Intronic
1165468367 19:35988423-35988445 CAGGGTCGGGAAATGAATGATGG + Intergenic
1165824220 19:38696472-38696494 CCGGGTAGGGAGAGGAAGGATGG + Intronic
1165905683 19:39193180-39193202 CAGGGTAGGGGTAGGCAGGAGGG + Intergenic
1166011896 19:39948904-39948926 CAAGGTGGGCAAGGGAAGGAGGG + Intergenic
1166397049 19:42449076-42449098 CTGTGTAGGCACAGGAAGAAAGG + Intergenic
1166456995 19:42949975-42949997 CTGGGTAGGCCCAGGAAGGGAGG - Intronic
1166466939 19:43040844-43040866 CTGGGTAGGCCCAGGAAGGGAGG - Intronic
1166486744 19:43220459-43220481 CTGGGTAGGCCCAGGAAGGGAGG - Intronic
1166493855 19:43283906-43283928 CTGGGTAGGCCCAGGAAGGGAGG - Intergenic
1166651838 19:44580842-44580864 CATGGTAGGCAAACGTGGGAGGG + Intergenic
1166699176 19:44872272-44872294 CAGTGTAGACAATGGCAGGAAGG - Intronic
1166776158 19:45314108-45314130 AAGGGAAGGGAAGGGAAGGAAGG + Intronic
1166977112 19:46611154-46611176 CCGGGTAGGGGAAGGACGGAAGG + Intergenic
1168189203 19:54725775-54725797 CAAGGTAGACACAGGATGGAGGG - Intronic
1168503909 19:56916785-56916807 GAAGGAAGGGAAAGGAAGGAAGG - Intergenic
1168503919 19:56916825-56916847 GAAGGAAGGGAAAGGAAGGAAGG - Intergenic
1168503927 19:56916855-56916877 AAGGGAAAGGAAAGGAAGGAAGG - Intergenic
1168503938 19:56916900-56916922 GAAGGGAGGGAAAGGAAGGAAGG - Intergenic
1168699374 19:58427434-58427456 AAGGGAAAGGAAAGGAAGGAAGG - Intergenic
925319119 2:2948606-2948628 CAGGCTAGGCAAGGGGAGCAGGG + Intergenic
925986774 2:9222808-9222830 GAGTGTAGACAATGGAAGGAAGG - Intronic
926116362 2:10216078-10216100 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
926317366 2:11720874-11720896 CAGGTTAGGCATATGAAGCAAGG + Intronic
926440382 2:12882732-12882754 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
927088160 2:19690488-19690510 GAGGGGAGGTAAAAGAAGGAAGG + Intergenic
927088172 2:19690521-19690543 GAGGGGAGGGAAAGGAAGGAGGG + Intergenic
927510907 2:23643075-23643097 CGGGGTAAGAAGAGGAAGGAAGG + Intronic
927526432 2:23745438-23745460 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
927602816 2:24459313-24459335 CAGTGGAGGCAAAGGAATGGAGG + Intergenic
928206417 2:29287803-29287825 CAGGGAAGGAAAAGGGTGGAAGG + Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
929005641 2:37390412-37390434 AGGAGTAGGCAGAGGAAGGAGGG + Intergenic
929321193 2:40545362-40545384 AAGTATAGGAAAAGGAAGGATGG - Intronic
929508301 2:42546089-42546111 CCTGGTAGGGAAGGGAAGGAGGG + Intronic
929823944 2:45295505-45295527 CATCGTAGGCAGAGAAAGGAGGG + Intergenic
930539741 2:52690648-52690670 GAGGGAAGGGAAGGGAAGGAAGG - Intergenic
930664724 2:54090662-54090684 CAGGATTGGCAAAGGCAGGAAGG - Intronic
931166726 2:59756827-59756849 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
931541389 2:63333406-63333428 CTGGATCTGCAAAGGAAGGAAGG - Intronic
931756534 2:65379601-65379623 CAGGGTTGTCATAGGAGGGAAGG - Intronic
932091418 2:68809311-68809333 TAGGGTAGGGAAAGGAGGGGAGG + Intronic
932231868 2:70089605-70089627 CAGGGAAAGGAAAGGAAGGGAGG + Intergenic
932530387 2:72523975-72523997 AAGGGAAGGGAAAGGAAGAAGGG + Intronic
932606368 2:73168461-73168483 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
932608799 2:73183275-73183297 AAGGGAAAGGAAAGGAAGGAAGG + Intergenic
932729902 2:74212199-74212221 GAGGGGAGGGGAAGGAAGGAAGG - Intronic
933664088 2:84950551-84950573 AAGGGAAGGGAAAGAAAGGAAGG + Intergenic
933769202 2:85732618-85732640 CAGGGCAGGCCAAGGAGGCATGG - Intergenic
933926062 2:87091981-87092003 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
933980606 2:87547305-87547327 CAGGGTAAGCATAGGAAGCACGG + Intergenic
934089168 2:88536189-88536211 GAAGGGAGGAAAAGGAAGGAGGG + Intergenic
934124188 2:88870639-88870661 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
934654250 2:96108991-96109013 CAGGATAGGGGAAGGGAGGAAGG + Intergenic
935017634 2:99199168-99199190 CAAAGTATGGAAAGGAAGGAAGG - Intronic
935245784 2:101217949-101217971 CAGGGGAGGCAAAGCAAGTCAGG + Intronic
935659718 2:105455805-105455827 CAGGAGAGGCAAAGGCTGGAGGG - Intergenic
935717559 2:105952526-105952548 GAGGGAAGGAAAAGGAAGGGAGG + Intergenic
935787166 2:106559689-106559711 AAGGGAAGGGAAAGGAAGGCAGG - Intergenic
936112371 2:109675753-109675775 CGAGAAAGGCAAAGGAAGGAAGG - Intergenic
936313221 2:111403486-111403508 CAGGGTAAGCATAGGAAGCACGG - Intergenic
936447429 2:112607160-112607182 GAGGGGAGGGAAAGAAAGGAGGG - Intergenic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936867570 2:117092608-117092630 CAGGGGAGGCCTAGGAAGGGAGG + Intergenic
936894199 2:117408018-117408040 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
936982324 2:118276249-118276271 CATGCCAGGCAAAGGAAGAATGG - Intergenic
937275103 2:120679163-120679185 CAGGGGAGGAAGAGGAAGCAGGG - Intergenic
937486157 2:122316856-122316878 CAGGAGAGGCAAAAGAAGAAAGG - Intergenic
937509056 2:122572498-122572520 CAGGGTGGGAGTAGGAAGGAGGG - Intergenic
937509835 2:122583043-122583065 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
937509847 2:122583084-122583106 AAGGAAAGGAAAAGGAAGGAAGG + Intergenic
937556351 2:123162633-123162655 AAGGGGAGGGAAGGGAAGGAAGG - Intergenic
937675731 2:124588120-124588142 GAAGGAAGGAAAAGGAAGGAAGG - Intronic
937675737 2:124588146-124588168 GAAGGAAGGAAAAGGAAGGAAGG - Intronic
937857165 2:126680802-126680824 CAGGTTAGGCAAAGGATGTGTGG + Intronic
937912309 2:127081587-127081609 GAGGGAAGCCTAAGGAAGGAGGG + Intronic
938018132 2:127885145-127885167 CAGCGGAGGTTAAGGAAGGAGGG + Intronic
938142014 2:128802359-128802381 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
939439410 2:142224694-142224716 AATGGTAGGAAAAGGTAGGAAGG + Intergenic
939665588 2:144947269-144947291 AAGGGAAAGGAAAGGAAGGAAGG - Intergenic
940656137 2:156489865-156489887 GAGGGGAGGGGAAGGAAGGAAGG - Intronic
940769725 2:157826894-157826916 GAAGGTAGGAAAAGAAAGGAAGG + Intronic
940925009 2:159355071-159355093 AAGGGGAGCCAAAGGAAAGATGG - Intronic
942018080 2:171837320-171837342 CATGGTTTGGAAAGGAAGGAAGG + Intronic
942289450 2:174454733-174454755 GAAGGAAGGAAAAGGAAGGAAGG + Intronic
942289464 2:174454781-174454803 AAGGGAAGGAAAGGGAAGGAAGG + Intronic
942289477 2:174454833-174454855 AAAGGAAGGAAAAGGAAGGAAGG + Intronic
942289489 2:174454879-174454901 GAAGGAAGGGAAAGGAAGGAAGG + Intronic
942318433 2:174715102-174715124 CTAGGGAGACAAAGGAAGGAGGG - Intergenic
943507739 2:188782962-188782984 CATGATTGGGAAAGGAAGGATGG - Intronic
943658458 2:190533700-190533722 CAGGGTAGCCAAAGCAAGGAAGG + Intronic
944389256 2:199200432-199200454 CAGGGTAGGAAAAAGATGGTTGG + Intergenic
945253566 2:207785049-207785071 CAGAGTAGGCTGAGGAATGATGG - Intergenic
945670359 2:212795011-212795033 CAGGGTGAGCTAAGGAAGGGGGG + Intergenic
945876145 2:215279950-215279972 AAGGAAAGGAAAAGGAAGGAAGG + Intergenic
946076128 2:217075181-217075203 CAGGGTAGAGAAAAGCAGGAAGG - Intergenic
946554962 2:220845990-220846012 AAGGGAAGGGAAGGGAAGGAGGG + Intergenic
947077035 2:226355862-226355884 AAGAGGATGCAAAGGAAGGAAGG + Intergenic
947390612 2:229635534-229635556 CAGGAAAGGCAACTGAAGGAGGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947702861 2:232249655-232249677 GAGGATTGGCAAAGGCAGGAGGG + Intronic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
947857513 2:233334039-233334061 CTGGCTAGGCACAGGATGGAGGG + Intronic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
947947750 2:234120932-234120954 ATGTGTTGGCAAAGGAAGGATGG - Intergenic
948002858 2:234582430-234582452 CAGAGGAGGCAAAGGAAAGAGGG - Intergenic
948106874 2:235421549-235421571 CAGGTTAGGGGGAGGAAGGAGGG - Intergenic
948109532 2:235443682-235443704 CAGGGGAGGGACAAGAAGGAGGG - Intergenic
948305416 2:236943799-236943821 CAGGGTAGACTGAGGATGGATGG + Intergenic
948366145 2:237456118-237456140 CAGGGTTGGCAATGGAAAGAAGG - Intergenic
948434916 2:237946480-237946502 GAGGGAAGGGAAGGGAAGGAAGG + Intergenic
948838934 2:240640055-240640077 GAAGGTAGGTCAAGGAAGGAAGG - Intergenic
948839035 2:240640393-240640415 GAAGGTAGGTCAAGGAAGGAAGG - Intergenic
948839050 2:240640443-240640465 GAAGGTAGGTCAAGGAAGGAAGG - Intergenic
1169176481 20:3520248-3520270 GAGGGAAGGGAAAGGAAGAAAGG + Intronic
1169467260 20:5852398-5852420 GAAGGGAGGGAAAGGAAGGAAGG - Intronic
1169842823 20:9958870-9958892 AAGGGAAGGAAAGGGAAGGAAGG - Intergenic
1169874511 20:10282220-10282242 GAAGGAAGGGAAAGGAAGGAAGG + Intronic
1169920635 20:10731005-10731027 GAGGGAAGGTAAAGGAATGAAGG - Intergenic
1170020697 20:11833955-11833977 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1170020713 20:11834019-11834041 AAGGCAAGGCAAGGGAAGGAAGG + Intergenic
1170020721 20:11834043-11834065 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1170632981 20:18080985-18081007 GAGGGCAGGGAAGGGAAGGAAGG + Intergenic
1170768323 20:19311019-19311041 AAGGGAAGGAAAGGGAAGGAGGG - Intronic
1171029526 20:21664870-21664892 AATGCTGGGCAAAGGAAGGATGG + Intergenic
1171159444 20:22908206-22908228 TAGGGAAGGAAAAGGAGGGAAGG - Intergenic
1172147008 20:32763758-32763780 CAGGGGAGGAAAAGGGAGCAGGG - Intronic
1172317983 20:33971223-33971245 CAGGGAAGGGGCAGGAAGGATGG - Intergenic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1172771701 20:37386009-37386031 CAGGGAAGGCATGGGCAGGATGG - Intronic
1173541639 20:43857156-43857178 CAGGGAAGGCAGAGGAGGAAGGG + Intergenic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1174106653 20:48167023-48167045 GAGGGAAGGCGAAGGAAGGGAGG - Intergenic
1174191352 20:48742879-48742901 CAGAGAAGCCAAAGGAATGAGGG + Intronic
1175361658 20:58415943-58415965 CAGAGTAGGGAGAGGAAGGTTGG + Intronic
1175651178 20:60724567-60724589 GAGGGAAGGAGAAGGAAGGAAGG + Intergenic
1176058532 20:63161513-63161535 CAGGGCAGGGAATGGCAGGAAGG - Intergenic
1176239173 20:64067995-64068017 AAGGGGAGGCAGAGGAGGGAGGG - Intronic
1177508860 21:22056412-22056434 CATGGTACGGAAAGGAAAGAAGG + Intergenic
1177894971 21:26846427-26846449 CCTGGTAGGAAGAGGAAGGAGGG - Intergenic
1178436171 21:32560297-32560319 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1178914411 21:36698812-36698834 CAGGGAGGGCGAGGGAAGGAGGG - Intergenic
1178978992 21:37245163-37245185 GTGGGAAGGGAAAGGAAGGAGGG + Intronic
1179050766 21:37887031-37887053 GAGGGTAGGAGAGGGAAGGAAGG - Intronic
1179061414 21:37983024-37983046 AAGGGAAGGGGAAGGAAGGAAGG - Intronic
1179061432 21:37983077-37983099 AAGGGCTGGGAAAGGAAGGAAGG - Intronic
1179434738 21:41352421-41352443 AAGGGAAGGGAATGGAAGGAAGG + Intronic
1179488956 21:41728059-41728081 CAGGGCCGGCTCAGGAAGGAGGG - Intergenic
1179650646 21:42806271-42806293 TTGGGTAGGTAAAGGAAGAAGGG + Intergenic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1181148346 22:20864798-20864820 CTGGGGAAGGAAAGGAAGGAGGG + Intronic
1181237351 22:21455704-21455726 CAGGGTTGGGAAAGGCAGGCAGG + Intergenic
1182418301 22:30235637-30235659 CAGGGCAGGGAAAGCAGGGAGGG + Intergenic
1183090036 22:35516036-35516058 AAGGGAAGGGAAGGGAAGGAGGG - Intergenic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1184635340 22:45824094-45824116 TGGGGAAGGCAAAGGAAGGTAGG - Intronic
1184694405 22:46131553-46131575 CAGTGTGGGCCATGGAAGGAGGG + Intergenic
1185135766 22:49071247-49071269 AAGGGAAGGGAAAGGAGGGAGGG - Intergenic
949405045 3:3705410-3705432 CGGGGGAGGGAAAGAAAGGAGGG + Intronic
949662992 3:6303550-6303572 CACAGTATGCAAAGGAAGGATGG - Intergenic
950193226 3:10992381-10992403 CGGGGCAGGCGAGGGAAGGAGGG + Intergenic
950282056 3:11716711-11716733 CAAGGTAGGAAAAGGAATGTAGG - Intronic
950622696 3:14218698-14218720 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
950622699 3:14218712-14218734 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
951593135 3:24288169-24288191 CAAGGTAGTAAAAGGAAGGCTGG + Intronic
951930123 3:27955892-27955914 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
952165101 3:30739322-30739344 GAGGATGGGCACAGGAAGGAGGG - Intronic
952569205 3:34694379-34694401 TAGGGAAAGGAAAGGAAGGAAGG - Intergenic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
953232026 3:41073963-41073985 TAGGGTAGGCAAGGGAAAAATGG - Intergenic
953431493 3:42844250-42844272 GAGGTGAGGCAGAGGAAGGAAGG + Intronic
954050929 3:47976466-47976488 CAGGGTAAGGAAAGGCTGGAGGG - Intronic
954293998 3:49664162-49664184 CAGGAAAGGGGAAGGAAGGAGGG - Intronic
954369372 3:50162222-50162244 CAGGGTAGATAAAGGAACAAAGG + Intronic
954396467 3:50295928-50295950 CAAGGTGGGCAGAGGAAAGAAGG - Intronic
954402234 3:50325131-50325153 CTGGGTAGGGAAAGAAAGGAGGG - Exonic
954414259 3:50385240-50385262 CTGGGGAGGCAAGGGAAAGAAGG + Intronic
955087787 3:55720016-55720038 GTGGGGAGGCAAGGGAAGGAGGG - Intronic
955099266 3:55831370-55831392 AAGGGAAGGGAAGGGAAGGAAGG + Intronic
955874597 3:63476214-63476236 GAGGGAAGGGAAGGGAAGGAAGG + Intronic
955874640 3:63476347-63476369 GAGGGAAGGGAAGGGAAGGAAGG + Intronic
955925451 3:63999860-63999882 AATGGTAGTAAAAGGAAGGAGGG - Exonic
956666006 3:71642655-71642677 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
956694506 3:71906980-71907002 AAGAGGAGGGAAAGGAAGGAAGG + Intergenic
956790262 3:72674607-72674629 CAGGGAAGGCAAGTGAAGGTTGG + Intergenic
956972051 3:74537640-74537662 TAGGGAAGGCAGAGGAAGGATGG + Intergenic
957640354 3:82845512-82845534 CAGGTTTGTCAAAGAAAGGATGG - Intergenic
958072062 3:88626983-88627005 CAGGGTTGGTAAGGGAAGGAAGG + Intergenic
958657525 3:97021383-97021405 CAGAGTAGTCACAGGAAGTAAGG - Intronic
959343478 3:105161560-105161582 CAGGGTAGTAATAGGAAGGTGGG - Intergenic
959512243 3:107226807-107226829 CAGAGGAGACACAGGAAGGAAGG + Intergenic
959568320 3:107855687-107855709 CATGGTAGGGAAAGAAAGGTAGG - Intergenic
959585075 3:108018310-108018332 CAGGGCAGGGGAAGGAGGGACGG - Intergenic
959856613 3:111166168-111166190 CAGAATGGGCAAAGGAAGGCTGG + Intronic
959931881 3:111993976-111993998 CAATGAAGGCATAGGAAGGAAGG + Intergenic
960373005 3:116864090-116864112 CATGGAAGGAAAGGGAAGGAGGG - Intronic
960446697 3:117758116-117758138 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
960446710 3:117758179-117758201 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
960551044 3:118976818-118976840 GGGGGTTGGCAAATGAAGGAAGG - Intronic
960947289 3:122975313-122975335 CAGCCTTGGCAGAGGAAGGAAGG + Intronic
962197345 3:133375840-133375862 CAGAGTGGGCAACAGAAGGAGGG - Intronic
962204820 3:133425927-133425949 TAGGGAAGGCAAGGGAAGGGAGG + Intronic
962213785 3:133502259-133502281 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
962332808 3:134494515-134494537 GAGGGTAGGTAAAAGAGGGAGGG + Intronic
963016235 3:140826762-140826784 CTGTGTAGGCAAAGGCAGGATGG - Intergenic
963471847 3:145750679-145750701 GAAGGAAGGGAAAGGAAGGAAGG + Intergenic
963681040 3:148376867-148376889 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
963745053 3:149117423-149117445 CAGGCTGAGCAAAGGAAGGTAGG - Intergenic
963809799 3:149764544-149764566 GAAGGAAGGGAAAGGAAGGAAGG - Intronic
964211582 3:154234246-154234268 CAGGATAGTGAAAGGAAGGATGG - Intronic
964248840 3:154686394-154686416 AAGGAAAGGAAAAGGAAGGAAGG - Intergenic
964382883 3:156115318-156115340 AAGGGAAAGGAAAGGAAGGAAGG + Intronic
964494489 3:157273495-157273517 CTATGAAGGCAAAGGAAGGAAGG + Intronic
964738588 3:159942103-159942125 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
965018032 3:163186029-163186051 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
965286334 3:166824697-166824719 CTGGGTAGGCACTGGAAGGAAGG + Intergenic
965947289 3:174258855-174258877 GAAGGGAGGAAAAGGAAGGAAGG + Intronic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966888577 3:184390164-184390186 AAGGGAAGGGAAGGGAAGGAGGG - Intronic
966907896 3:184541105-184541127 CAGGGTGGGCCAAGTAAAGAAGG - Intronic
967007721 3:185400030-185400052 CAGGGTAGAAAATGGAGGGAGGG - Intronic
967020996 3:185522464-185522486 AAGGGAAGGGAAAGGAAAGAAGG + Intronic
967021001 3:185522486-185522508 GAAGGAAGGAAAAGGAAGGAAGG + Intronic
967021010 3:185522516-185522538 GAAGGAAGGGAAAGGAAGGAAGG + Intronic
967305221 3:188052606-188052628 CAGGGTAGCAAAAGGAACGTGGG + Intergenic
967350747 3:188511260-188511282 GAAGGGAGGGAAAGGAAGGAGGG - Intronic
967360496 3:188624768-188624790 GAAGGAAGGAAAAGGAAGGAAGG - Intronic
967446932 3:189577908-189577930 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
967676481 3:192305058-192305080 CAGAGAAGGGAGAGGAAGGAGGG + Intronic
967789468 3:193531393-193531415 GAGGGAAGGGAAAGGAAGGAAGG + Intronic
968650991 4:1760220-1760242 CAGGGTAGGAGCAGGTAGGAGGG + Intergenic
968781151 4:2582448-2582470 GAGGGAAGGAGAAGGAAGGAAGG - Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
968942839 4:3648047-3648069 CAGGGTAGGGGCAAGAAGGATGG - Intergenic
969003338 4:4000229-4000251 TTGGGTAGGCAAAGGAAAAAGGG + Intergenic
969065665 4:4478584-4478606 CAGGGTGGACAAAAGAAAGATGG + Intronic
969345937 4:6570029-6570051 GAGGGAAGGGAAGGGAAGGAAGG + Intergenic
969481591 4:7449355-7449377 GAGGGGAGAGAAAGGAAGGAAGG - Intronic
970050831 4:11913156-11913178 CAATGCAGGCAAAAGAAGGAGGG + Intergenic
970083201 4:12314083-12314105 CAGGGTAGAAAGTGGAAGGAGGG + Intergenic
970111803 4:12645889-12645911 CAGGGCAGGGAAAGAAAGGAAGG + Intergenic
970146467 4:13041578-13041600 CAGGGTAGGCAAGGAAAACATGG - Intergenic
970331803 4:14994202-14994224 CAAGGTAAGGAAAGGAAGGAGGG - Intergenic
970471402 4:16382802-16382824 GAGGGAAGGAGAAGGAAGGAAGG - Intergenic
970502343 4:16690538-16690560 GAGGTTGGGGAAAGGAAGGAAGG + Intronic
970855220 4:20643668-20643690 CAAGTCAGGGAAAGGAAGGATGG - Intergenic
971551536 4:27964243-27964265 CAGGGAAGGGAAGGGAAGGCTGG - Intergenic
971706690 4:30052997-30053019 CATGGTAGCCAAAGTAAAGAGGG + Intergenic
972513693 4:39793481-39793503 GAAGGAAGGGAAAGGAAGGAAGG - Intergenic
973544378 4:51966158-51966180 GAGGGAAGGAGAAGGAAGGAGGG - Intergenic
973610610 4:52632869-52632891 CAGAGAAAGAAAAGGAAGGAAGG + Intronic
973809443 4:54556022-54556044 CAGTGTAGGAAAAGAAAGGGTGG + Intergenic
974146459 4:57953600-57953622 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
974374811 4:61062245-61062267 AAGGGAAGGGAAGGGAAGGAGGG + Intergenic
974880884 4:67756225-67756247 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
975143385 4:70940297-70940319 CTGGGTAGACAGAGGAAGGTGGG - Intronic
975960375 4:79897069-79897091 AAAGGAAGGAAAAGGAAGGAAGG + Intergenic
976006009 4:80431435-80431457 AAAGGGAGGCAAAGAAAGGAAGG - Intronic
976195793 4:82530135-82530157 GAGGGAGGGCAAAGGAGGGATGG + Intronic
976266355 4:83189092-83189114 GAGGGTGGCAAAAGGAAGGAGGG + Intergenic
978223422 4:106304925-106304947 GAGGGTAGACAAAGGAAGAGGGG - Intronic
978900836 4:113947618-113947640 GAAGGAAGGGAAAGGAAGGAAGG + Intronic
979548980 4:121969143-121969165 CAGTGGAAGAAAAGGAAGGAGGG - Intergenic
979698518 4:123640866-123640888 GAAGGTAGGGAAAGGAAGGAAGG + Intergenic
979849559 4:125559584-125559606 GAGGGAGGGAAAAGGAAGGAAGG - Intergenic
979987746 4:127336128-127336150 CTGGGTAGGGAAACGAAGAATGG - Intergenic
980196539 4:129596153-129596175 GAGGGAAGGGAAGGGAAGGAAGG + Intergenic
980505129 4:133709275-133709297 AAGGGAAGGGAAAGGAGGGAGGG - Intergenic
980746200 4:137020041-137020063 CAGGGAAGGCAAATGAGGTATGG + Intergenic
980806948 4:137827773-137827795 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
980806976 4:137827846-137827868 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
980807054 4:137828053-137828075 GAAGGAAGGGAAAGGAAGGAAGG + Intergenic
980807098 4:137828178-137828200 AAGGGGAAGAAAAGGAAGGAAGG + Intergenic
980807110 4:137828216-137828238 AAGGGGAAGAAAAGGAAGGAAGG + Intergenic
980929156 4:139168959-139168981 CAGGGAAGGCCATGAAAGGAGGG + Intronic
980992623 4:139751083-139751105 CAGAGTAGGCAAAGAAAGATGGG + Intronic
981892898 4:149760024-149760046 AAGGGAAGGGAAGGGAAGGAGGG + Intergenic
982085837 4:151835320-151835342 CATGGTGGGCAAAGGATGCAGGG + Intergenic
983050467 4:163040286-163040308 AAGGGAAGGGAAAGGAAGGAGGG + Intergenic
983630385 4:169843687-169843709 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
983727954 4:170953701-170953723 AAGGGAAGGGAAAGGAAGGAAGG - Intergenic
983956454 4:173704154-173704176 GAGGGTATGCAAAGAAAAGAAGG - Intergenic
983964995 4:173799104-173799126 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
984053734 4:174899645-174899667 CAGGGTAGGTTTAGGAAGGAAGG + Intronic
984412006 4:179407226-179407248 CAGGGGAGGAACAGGAAAGAAGG - Intergenic
984612403 4:181856164-181856186 AAGGGAAGGAAAGGGAAGGAAGG + Intergenic
984742048 4:183174251-183174273 CAGGTTGGGCAAAGGCAGGCAGG + Intronic
984824701 4:183914116-183914138 CTGAGTAGGCCAAGGGAGGAGGG + Intronic
985273364 4:188216044-188216066 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
986055733 5:4135316-4135338 GAGGGTGGGAAATGGAAGGAGGG + Intergenic
986240339 5:5954853-5954875 GAGGGAAGGGAAAGGAGGGAAGG - Intergenic
986240395 5:5955041-5955063 GAGGGAAGGGCAAGGAAGGAAGG - Intergenic
986468391 5:8050063-8050085 AAGGGGAAGGAAAGGAAGGAAGG + Intergenic
986636082 5:9823655-9823677 GAAGGGAGGGAAAGGAAGGAAGG + Intergenic
986677266 5:10196998-10197020 CAAAGTAGGCAAAGGAAGGTGGG + Intergenic
987039037 5:14044724-14044746 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
987396832 5:17432070-17432092 AAGGGAAGGGAAAGGAAGGGAGG - Intergenic
987785817 5:22497420-22497442 ACGGGTGAGCAAAGGAAGGAAGG - Intronic
987933055 5:24427412-24427434 CAGGGAAGGCACAGGAAGTGTGG + Intergenic
989196271 5:38719641-38719663 GAGGGAAGAGAAAGGAAGGAAGG - Intergenic
990069870 5:51768145-51768167 GAGGGAGGGAAAAGGAAGGAAGG - Intergenic
990186261 5:53213048-53213070 CTGGATATGGAAAGGAAGGAAGG + Intergenic
990316392 5:54586820-54586842 CAGGGCAAGCCAAGGATGGAAGG + Intergenic
991348266 5:65693205-65693227 AAGGGAAGGGAAGGGAAGGAAGG + Intronic
992963255 5:81976351-81976373 CATGGTGGTCAAAGGAAAGAAGG + Intronic
993213510 5:84987266-84987288 CATGGTAGCCAATGGTAGGATGG + Intergenic
993466996 5:88260693-88260715 CATGGAAGGCTAAGGCAGGAGGG - Intronic
993899905 5:93578450-93578472 CCAGGAAGGCAGAGGAAGGAAGG + Intergenic
994416484 5:99477930-99477952 AGAGGTAGGCAAATGAAGGATGG + Intergenic
994463484 5:100097239-100097261 AGAGGTAGGCAAATGAAGGATGG - Intergenic
994681931 5:102899039-102899061 GAGGGGAGGGAAAGGAAGGGAGG - Intronic
995324534 5:110875381-110875403 AAGGGAAGGGAAAGGAGGGAGGG - Intergenic
996757979 5:126954887-126954909 CTGGGAAGGGAAAGGAAGGCAGG - Intronic
997338796 5:133126547-133126569 CAGAGAAGGGAAGGGAAGGAAGG + Intergenic
998180771 5:139939039-139939061 GAAGGAAGGGAAAGGAAGGAAGG + Intronic
998187928 5:139997274-139997296 CTGGGTGGGTAAAGGAAGGGTGG - Intronic
998325337 5:141275048-141275070 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
998443729 5:142182549-142182571 CATGGTTGGCAAAGATAGGAAGG + Intergenic
998589426 5:143461824-143461846 GAAGGAAGGGAAAGGAAGGAAGG - Intergenic
999283491 5:150380122-150380144 CAGGTAAGGAAAAGAAAGGAAGG + Intronic
999936707 5:156494430-156494452 TTTGCTAGGCAAAGGAAGGAGGG + Intronic
1000009290 5:157216624-157216646 GTGGGGAGGGAAAGGAAGGAAGG + Intronic
1000185204 5:158851785-158851807 AAGGGAAGGAAAGGGAAGGAGGG + Intronic
1000734562 5:164882821-164882843 CAGAAGAAGCAAAGGAAGGAAGG - Intergenic
1000885627 5:166744388-166744410 GTGGGTAGGTAAAGGAAAGAGGG + Intergenic
1001325750 5:170722537-170722559 CAGGGTAGGGAACTGAAGGCAGG + Intronic
1001519014 5:172377457-172377479 CAGGATTTGAAAAGGAAGGAAGG - Intronic
1001639746 5:173236066-173236088 CAGGGAGGGCACGGGAAGGAGGG - Intergenic
1002279769 5:178123476-178123498 CAGGGTAGCCAAAGGGAGTGAGG - Exonic
1002713310 5:181208466-181208488 CACGGTAGCCAAAAGGAGGAAGG - Intergenic
1002940873 6:1714652-1714674 CAGAGTGGGTAAAGGAAAGATGG + Intronic
1003031533 6:2605326-2605348 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1003599445 6:7503641-7503663 CAGGCAAGGCAAGGAAAGGATGG - Intergenic
1003605110 6:7552688-7552710 ATGGGTAGGCAAGGGAAGGCAGG + Intronic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1003867984 6:10381056-10381078 GAAGGGAGGCAGAGGAAGGAAGG - Intergenic
1004473279 6:15947868-15947890 CAGGAGAGGCACAGGAAGGAGGG + Intergenic
1004898096 6:20168720-20168742 AAGGGAAGGAAAAGGAAGGGAGG + Intronic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1004947834 6:20635342-20635364 CAGGGACTACAAAGGAAGGAAGG - Intronic
1004958436 6:20756948-20756970 CACAGTAAGGAAAGGAAGGAAGG - Intronic
1005223893 6:23619914-23619936 AAGGGAAGGAAAGGGAAGGAAGG + Intergenic
1005732068 6:28707565-28707587 GAAGGGAGGGAAAGGAAGGAAGG + Intergenic
1006059971 6:31412259-31412281 CAGGGTAGGGACAGCAGGGATGG + Intronic
1006072459 6:31507334-31507356 CAGGGTAGGAACAGCAAGGACGG + Intronic
1006088727 6:31615465-31615487 CAGGGTAAGGAGAGGAAGGGAGG + Intronic
1006391806 6:33763036-33763058 CAGGGAGGGAAAAGGAGGGAAGG + Intergenic
1006591307 6:35160034-35160056 AAGGGTAGGACAAGGCAGGACGG - Intergenic
1007303256 6:40884648-40884670 TAAGGTAGGGAAAGGAAGGAGGG + Intergenic
1007388384 6:41534893-41534915 GAGGGTAGGCAGGGTAAGGATGG - Intergenic
1007470025 6:42083793-42083815 CAAGACAAGCAAAGGAAGGAAGG + Intronic
1007663604 6:43501437-43501459 CAGAGTGGGCTCAGGAAGGAAGG - Intronic
1007777994 6:44234447-44234469 CAGTGAAGACAAAGGAAAGATGG - Intergenic
1008304599 6:49886180-49886202 CAGGGTAGCCAAGGGAAGAAAGG - Intergenic
1008515344 6:52313769-52313791 GAGGGGAGGCAAAGGAAAGTGGG - Intergenic
1008808490 6:55462324-55462346 CATGGTGAGCATAGGAAGGAAGG - Intronic
1009158479 6:60252361-60252383 CAGGGGAGGCATAGGAGGGGTGG + Intergenic
1009295648 6:61943043-61943065 GAAGGGAGGGAAAGGAAGGAAGG + Intronic
1009343797 6:62589620-62589642 CTGTGTAGGCACAGGAAGAAAGG - Intergenic
1009761529 6:68012957-68012979 AAGGGAAGGGAAAGGAAGGGAGG + Intergenic
1009828393 6:68897597-68897619 GAGGGCAGGAAGAGGAAGGAAGG + Intronic
1009828423 6:68897728-68897750 GAGGGCAGGAAGAGGAAGGAAGG + Intronic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1010268997 6:73900440-73900462 CAAGGAAGGAAAAGGAAGCAAGG + Intergenic
1010357205 6:74948267-74948289 AAGGAGAGGAAAAGGAAGGAAGG + Intergenic
1010361737 6:75003508-75003530 CAGGGTTGGCAGAGGAAGTGTGG + Intergenic
1011704465 6:89987015-89987037 CAGAGTAGGCGACGGAAGGCTGG - Intronic
1011874985 6:91948286-91948308 CAGGGTTTGGAAAGGAGGGAGGG + Intergenic
1011999750 6:93638256-93638278 AAAGGTAGCAAAAGGAAGGAAGG - Intergenic
1012533557 6:100268068-100268090 CAGGAGAGGAAAAGGAAGGCTGG - Intergenic
1013294225 6:108744221-108744243 CAAGGGAAGCAAGGGAAGGAAGG + Intergenic
1013673505 6:112431459-112431481 GAGGGTAGGGAAAGGAGGAAGGG + Intergenic
1013680375 6:112518884-112518906 CAGGGAAAGCAGAGGAAGAAAGG + Intergenic
1013765887 6:113573717-113573739 CAGGGTAGAGGAAGGAAAGAAGG - Intergenic
1014378144 6:120702836-120702858 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
1014999820 6:128200999-128201021 CAGGGTAGGCTCAGTAAGGTAGG - Intronic
1015017525 6:128432008-128432030 GAGGGAAGAGAAAGGAAGGAAGG + Intronic
1015461905 6:133501004-133501026 CAGGGAAGGGAAAGGAAACAAGG - Intronic
1015572606 6:134636854-134636876 GAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1015849009 6:137552420-137552442 GAGGGGAGGGAAGGGAAGGAAGG - Intergenic
1016205298 6:141460521-141460543 TTGGGTAGGCAAAGGAAAAAGGG - Intergenic
1016371735 6:143381874-143381896 GTGGTTAGGGAAAGGAAGGAAGG + Intergenic
1016448381 6:144156038-144156060 GAGGGGAGGGGAAGGAAGGAAGG - Intronic
1016664416 6:146619438-146619460 GAGGGTGGGAAAAGGAAGAAAGG - Intronic
1017193515 6:151677798-151677820 CAGAGTTTGCAAAGGGAGGAGGG + Intronic
1017348896 6:153416492-153416514 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1017726486 6:157279620-157279642 GAGGGCAAGGAAAGGAAGGAAGG + Intergenic
1017747280 6:157458161-157458183 CAGGGTAGGTAGAAGAAGGGAGG + Intronic
1018294982 6:162336047-162336069 CAGGGTAAGCAAGGGCAGCAAGG + Intronic
1019376991 7:697948-697970 GAGGGAAGGGAAGGGAAGGAAGG + Intronic
1019487588 7:1296444-1296466 CAGGTTTGGCAAGGGACGGACGG - Intergenic
1019769396 7:2874168-2874190 CAGAGTAGATAAAGCAAGGATGG - Intergenic
1019846598 7:3509045-3509067 CAGGGCAGCCTAAGGAAGGTGGG + Intronic
1019917941 7:4145243-4145265 CAGGGAAGACAAAGGAGGGAAGG + Intronic
1019947708 7:4343111-4343133 GAGGGAAGGGAAGGGAAGGAGGG - Intergenic
1020158130 7:5744457-5744479 CAAGGGAGGGAAGGGAAGGAGGG + Intronic
1021331627 7:19345581-19345603 CAGGCTAAGGGAAGGAAGGAAGG - Intergenic
1022295439 7:29047072-29047094 AAGGGAAGGAAAAGAAAGGATGG - Intronic
1022333930 7:29405443-29405465 CAGGGGAGGCAATGCCAGGAAGG - Intronic
1022357017 7:29625681-29625703 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
1022495320 7:30849621-30849643 CAGCGGAGGCAGAGGAAGAAGGG - Intronic
1022804107 7:33804633-33804655 CAGGGTGGCCAAAGCAACGAAGG - Intergenic
1023340504 7:39214321-39214343 CAGGGGAGGAGGAGGAAGGAAGG - Intronic
1023627621 7:42132013-42132035 TAGGGTTGGAGAAGGAAGGATGG + Intronic
1023911189 7:44558181-44558203 GAGGGAAAGGAAAGGAAGGAAGG - Intergenic
1024060504 7:45694888-45694910 CAGGTTAGGCAAAGGACTGTAGG - Intronic
1024509754 7:50194400-50194422 CTGAGTAGGCATTGGAAGGATGG - Intergenic
1024669871 7:51584737-51584759 CAGGGCAGGGAAGGGAAGCAGGG - Intergenic
1024966364 7:55025471-55025493 CAGGGAAGGGAAGGGAAGGGAGG + Intronic
1025078552 7:55963807-55963829 AAAGGGAGGGAAAGGAAGGAAGG - Intronic
1025698892 7:63797900-63797922 GAGGGAAGGAAAAGAAAGGAAGG - Intergenic
1026149186 7:67773669-67773691 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
1026282333 7:68933080-68933102 CAGGGTAGAGGGAGGAAGGAAGG - Intergenic
1026433980 7:70377633-70377655 CAGGGTTGGGGAAGGAAGAATGG - Intronic
1026526337 7:71156630-71156652 CAGGGAGGGGAAGGGAAGGAAGG - Intronic
1026542806 7:71295525-71295547 AGGGGAAGGGAAAGGAAGGAAGG - Intronic
1027820148 7:83032426-83032448 CAAGGGAGGGAAGGGAAGGAAGG - Intronic
1027874988 7:83757127-83757149 AAGGGAAGGCAAAGGAGGGAGGG + Intergenic
1028349026 7:89820182-89820204 CAGGGCAGGCGAGGGAGGGATGG + Intergenic
1029165271 7:98584841-98584863 GAGGGAAGAGAAAGGAAGGAAGG - Intergenic
1029319030 7:99741131-99741153 CAGGGTAGGCAAAAGAAGCTAGG - Intergenic
1029350755 7:100011291-100011313 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
1029534130 7:101145906-101145928 AAGGGGAAGGAAAGGAAGGAAGG + Intergenic
1029612785 7:101636287-101636309 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1030017012 7:105232989-105233011 CAGCCTAGGCAAAGGAAAGGAGG + Intronic
1030077109 7:105746226-105746248 CAGTGTAGACACAGGAAGGGTGG - Intronic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1030263032 7:107586064-107586086 CAGAGTAGCCCAAGAAAGGAAGG + Intronic
1030297172 7:107940779-107940801 AGGGGGAGGCAAAGGCAGGACGG - Intronic
1030396338 7:108991056-108991078 CAGGGTCTGGGAAGGAAGGAAGG + Intergenic
1030927845 7:115479639-115479661 TAGGTTAAGGAAAGGAAGGAAGG - Intergenic
1031168454 7:118260651-118260673 GAGGGGAGGAAAAGGGAGGAAGG - Intergenic
1031670211 7:124533599-124533621 CATGGTGGACAAAGGAAGGGAGG + Intergenic
1031847381 7:126822508-126822530 CAAGGAAGGGAAGGGAAGGAAGG - Intronic
1031912502 7:127532768-127532790 GAGGGAAGGGAAAGGAAGGAGGG + Intergenic
1031917190 7:127574647-127574669 CAGGGGAGGAAAGGGAAGGCTGG + Intergenic
1031929832 7:127673977-127673999 AAGGGAAGGAAAGGGAAGGAAGG - Intronic
1031964167 7:128015486-128015508 AAGGGTAGGAAAAGGAAGAAAGG - Intronic
1031970171 7:128059068-128059090 CAGGGTAGAAGAAGGAACGAGGG - Intronic
1032401846 7:131629395-131629417 CAGGGGAAGCAAAGGAAATAGGG - Intergenic
1032439744 7:131933312-131933334 CAGGGAAGGAATAGGAAGGAAGG + Intergenic
1032517622 7:132518832-132518854 TGGGGGAGGGAAAGGAAGGAGGG - Intronic
1033301331 7:140188727-140188749 GAGGGGAGGGGAAGGAAGGAAGG + Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1033832609 7:145271598-145271620 GAGGGGAGGAAGAGGAAGGAAGG + Intergenic
1033959405 7:146895206-146895228 GAAGGAAGGAAAAGGAAGGAAGG - Intronic
1034275977 7:149824046-149824068 CAGGGTAGACTAAGGGAGGCAGG - Intergenic
1034460665 7:151196217-151196239 CGGGGGAGGCAGAGGAAGGTGGG + Intronic
1034543252 7:151773101-151773123 AAGGGAAGGGAAGGGAAGGAAGG + Intronic
1034653677 7:152712662-152712684 GAGGGAAGGGAAGGGAAGGAAGG - Intergenic
1035143315 7:156786195-156786217 TAGGGAAGGGAAGGGAAGGAAGG + Intronic
1035568750 8:658878-658900 AAGGAAAGGCAGAGGAAGGACGG - Intronic
1036186375 8:6625968-6625990 CAGAGGAGGGAAAGGAAGGTGGG + Intronic
1036258488 8:7222829-7222851 CATGGTGGGCAAGGGGAGGAAGG + Intergenic
1036308132 8:7616679-7616701 CATGGTGGGCAAGGGGAGGAAGG - Intergenic
1036310543 8:7681425-7681447 CATGGTGGGCAAGGGGAGGAAGG + Intergenic
1036358988 8:8064680-8064702 CATGGTGGGCAAGGGGAGGAAGG - Intergenic
1036624910 8:10462172-10462194 GAGGGCAGGGAAAGGAAGGAAGG - Intergenic
1036678188 8:10852003-10852025 CGGGGAAGGGAAAGGAAGCACGG + Intergenic
1037521782 8:19686794-19686816 CAGGGCAGTCAGAGGATGGATGG - Intronic
1037920187 8:22800548-22800570 CAGGGTGGGCACAGCAATGAGGG - Intronic
1038178978 8:25208854-25208876 GAGGGAAGGCAAAGAAATGAAGG - Intronic
1038687825 8:29734442-29734464 CAGGGTAGAGAAAGGAGTGATGG - Intergenic
1038799229 8:30734117-30734139 CCCGGTAGGCAAAGGAAGGAAGG + Intronic
1039272767 8:35900849-35900871 CACGGGAAGAAAAGGAAGGATGG - Intergenic
1039364540 8:36916222-36916244 AAGGGAAGGCAAAGAAAGGAAGG + Intronic
1039562683 8:38525836-38525858 AAGGGAAGGGAAACGAAGGAAGG - Intronic
1039562697 8:38525879-38525901 AAGGGAAGGGAAAGGAAGGAAGG - Intronic
1039750401 8:40473288-40473310 AAGGGAAGGAAAGGGAAGGAAGG + Intergenic
1039798765 8:40936733-40936755 GAGGGAGGGGAAAGGAAGGAAGG + Intergenic
1039848538 8:41343217-41343239 CAGGGAAGGAAAAGGAAAGCAGG - Intergenic
1040565133 8:48558170-48558192 CAGGGAAGGCACAGGCAGGGTGG - Intergenic
1040625747 8:49147987-49148009 CTGGGTTGGCAGAGGAGGGACGG + Intergenic
1040852417 8:51914615-51914637 CAGGGAAGGAAAGGGAAGGAAGG - Intergenic
1041628169 8:60054997-60055019 GAGGGAAGGGAAGGGAAGGAGGG + Intergenic
1042421056 8:68589812-68589834 GAGGGAAGGGGAAGGAAGGAAGG + Intronic
1042525576 8:69761454-69761476 CAGTGTAATCAAAGGAAAGACGG - Intronic
1042787356 8:72563590-72563612 GAGGGAAAGCAAAGGAAGAAAGG + Intronic
1042942481 8:74121845-74121867 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
1043014185 8:74917925-74917947 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1043159603 8:76829392-76829414 CAGGGAAGGAAAAGGTAGAAAGG + Intronic
1043323641 8:79022406-79022428 CAAGGTGGGGAAAGGAAGAAGGG + Intergenic
1043417291 8:80064042-80064064 CAGGGTAGGGAAGGGAAGGGAGG + Intronic
1043453016 8:80387114-80387136 TAGGGCAGGGAAAGGAAGAATGG + Intergenic
1043511254 8:80952518-80952540 GAGGGTGAGCAAAGGAAGGTGGG + Intergenic
1043653506 8:82631188-82631210 AAGTGAAGGCAAAGGAAGGCAGG - Intergenic
1044055565 8:87565912-87565934 AAGGAAAGGCAAAGGATGGAAGG - Intronic
1044299061 8:90562799-90562821 GAGGGAAGACAATGGAAGGAGGG - Intergenic
1045516392 8:102864005-102864027 CAGCGCAGGCAAAAGAAGAAAGG + Exonic
1045850774 8:106696118-106696140 CAGGGAAAGAAAGGGAAGGAGGG - Intronic
1045950733 8:107848965-107848987 AAGGGAAGGGGAAGGAAGGAAGG + Intergenic
1046066210 8:109199678-109199700 CGGGGTAGGCATAGAAGGGAAGG + Intergenic
1046419716 8:113964372-113964394 CTGGGTAGGAGAAGGAGGGATGG - Intergenic
1046451984 8:114405435-114405457 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
1046521943 8:115336202-115336224 GAGGTTAGGCAAGGGTAGGAAGG - Intergenic
1046605434 8:116366151-116366173 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1046605444 8:116366200-116366222 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1046724843 8:117663101-117663123 GAGGGTAGGGAAAGGATGAATGG + Intergenic
1046942581 8:119945217-119945239 CAGGTTAGGAAAAGGAGGAAGGG - Intronic
1047231290 8:123000335-123000357 AAGGGAAGGGAAGGGAAGGAGGG + Intergenic
1047501539 8:125445631-125445653 CAGGGGAGACAAAGGAGAGAGGG - Intergenic
1047548579 8:125844203-125844225 CAGGGTGAGCAAAAAAAGGATGG - Intergenic
1047734025 8:127750234-127750256 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
1047741837 8:127812642-127812664 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1047794707 8:128242840-128242862 AAGGGAAGGGAAGGGAAGGAAGG - Intergenic
1048053993 8:130846606-130846628 GAAGGAAGGAAAAGGAAGGAAGG - Intronic
1048232794 8:132660132-132660154 CAGGCTAGCCAAATGAAGGTAGG - Intronic
1048297717 8:133226974-133226996 CACGAGAGGCAAAGGCAGGAGGG + Intronic
1048329101 8:133460256-133460278 GAGGGAAGGAATAGGAAGGAGGG + Intronic
1048382104 8:133874281-133874303 CAGGCTGGCCAAAGGAAGGCTGG + Intergenic
1048668105 8:136687163-136687185 CTGGGTAGGTAAAGGAAAAAGGG - Intergenic
1048728716 8:137413622-137413644 CTGGGTAGGTAAAGGAAAAAGGG + Intergenic
1048837889 8:138538388-138538410 AAGGGAAGGGAAAGGAAGAAGGG + Intergenic
1048855914 8:138686468-138686490 AAGGATATGCAAAGCAAGGATGG + Intronic
1049291632 8:141806374-141806396 CAGGACATGGAAAGGAAGGAGGG - Intergenic
1049362872 8:142220537-142220559 CAGGTTAGGCCAGGGAGGGAGGG + Intronic
1049439993 8:142604977-142604999 CAGGTCAGGCAAAGGAACAAAGG + Intergenic
1049579268 8:143404053-143404075 CAGGGTGGGCAAAGGCTGGGAGG - Intergenic
1049653399 8:143787157-143787179 CAGGGTATTCAAAGCAAGCAGGG + Intergenic
1049737768 8:144218828-144218850 CAGGGGAGGGGAAGGGAGGAGGG - Intronic
1050143572 9:2541929-2541951 CAGGGAATGAGAAGGAAGGAAGG - Intergenic
1050722464 9:8606180-8606202 AAGGGAAGGAAAAGAAAGGAGGG + Intronic
1051470991 9:17441867-17441889 AAGGGTAAGCAAAGGAGAGAAGG + Intronic
1051861410 9:21628992-21629014 CAAGGCAGGCAAAAGAAGGAGGG + Intergenic
1052231071 9:26153438-26153460 CAGGGGAAGGAAGGGAAGGAAGG + Intergenic
1052325849 9:27216084-27216106 CAGGGTTGGAAGAGGAAGCAAGG + Intronic
1052336764 9:27328219-27328241 CAGGTTAGGAAGAAGAAGGAGGG + Exonic
1052593989 9:30536073-30536095 AAGGGGAGGGAAGGGAAGGAAGG - Intergenic
1052994098 9:34540705-34540727 CAGGGTGGGCTTAGGAAGGGAGG - Intergenic
1053388127 9:37711485-37711507 CGGGGAAGGCAAAGGGTGGAGGG + Intronic
1055186040 9:73455327-73455349 AAGGGAAGGCAAAGGAAGGGAGG - Intergenic
1055360122 9:75480722-75480744 CAGGATAGGCAAACAGAGGAGGG + Intergenic
1055728998 9:79261522-79261544 CAGTGTGGGCAAGGGAGGGATGG - Intergenic
1055768057 9:79686564-79686586 CAGAGGAGGCACAGAAAGGAAGG + Intronic
1056216718 9:84411987-84412009 CAGGGAAGGCAGAGGAAGAGGGG - Intergenic
1056272350 9:84958680-84958702 CTGGGTAGGGAAGTGAAGGATGG + Intronic
1056278025 9:85012227-85012249 TATGGGAGGCAAAGGCAGGAGGG - Intronic
1056408387 9:86299062-86299084 CAGGTCAGCCAGAGGAAGGAGGG + Intronic
1056613678 9:88142465-88142487 GAAGGAAGGAAAAGGAAGGAAGG - Intergenic
1056620850 9:88212778-88212800 CAGGTTAGGAAAGGGAAGGAGGG + Intergenic
1057901235 9:98950526-98950548 AAGGGAAGGGAAGGGAAGGAAGG - Intronic
1058004819 9:99903572-99903594 AAGGAAAGGAAAAGGAAGGAAGG + Intergenic
1058121833 9:101147578-101147600 CAGGGAAGGAGAAGGAAAGAGGG + Intronic
1058167047 9:101632034-101632056 AAGGCTAGGAAAAGGAAGGCAGG - Intronic
1058394855 9:104539391-104539413 GAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1058960492 9:109988671-109988693 AAGGGAAGGGAAAGGAAGGGCGG + Intronic
1058996669 9:110305744-110305766 AAGGGAAGGGAAGGGAAGGAAGG - Intronic
1059337650 9:113579330-113579352 CAGAATAGGCTAAGGAGGGATGG - Intronic
1059428649 9:114236838-114236860 CACAGCAGGGAAAGGAAGGAAGG + Intronic
1059725259 9:117002446-117002468 CAGAGTAAGCAATGGAAAGAGGG + Intronic
1060044889 9:120332120-120332142 TAGGGAAGGCAAGAGAAGGATGG - Intergenic
1060197993 9:121635607-121635629 CAGGGCAACCACAGGAAGGAGGG + Intronic
1060242863 9:121919548-121919570 CCTGGTAGCCAAAGGAAAGAAGG + Intronic
1060297792 9:122355039-122355061 GAGGGAAGGAAGAGGAAGGAGGG + Intergenic
1061067088 9:128285268-128285290 GAAGGAAGGGAAAGGAAGGAAGG + Intronic
1061273948 9:129558786-129558808 CAGGGTGAGGGAAGGAAGGAAGG + Intergenic
1061331877 9:129899777-129899799 GAGGGAAGGGAAGGGAAGGAAGG + Intronic
1061676013 9:132216063-132216085 CAAGCTAGGCAAAGGCAGGAAGG - Intronic
1062074307 9:134576065-134576087 CAGGGGAGGCCCAGGCAGGAAGG + Intergenic
1062143379 9:134972798-134972820 AAGGGAAGGGAAAGGAAGGGAGG + Intergenic
1203483940 Un_GL000224v1:34408-34430 CAAGGAATGCAATGGAAGGATGG - Intergenic
1185630797 X:1514708-1514730 AAGGGAAGGGAAGGGAAGGAAGG - Intronic
1185630810 X:1514745-1514767 AAGGGAAGGGAAGGGAAGGAAGG - Intronic
1185630822 X:1514779-1514801 AAGGGAAGGAAAAGGAAGGGAGG - Intronic
1185674057 X:1834438-1834460 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
1185680143 X:1881635-1881657 GAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1186303434 X:8227192-8227214 GAAGGAAGGGAAAGGAAGGAAGG - Intergenic
1186483177 X:9911680-9911702 CAGGGAAGACAAAGGCAGGCTGG - Intronic
1186549849 X:10492361-10492383 CAGGGTAGGCTGAGCAAGGAGGG - Intronic
1186751257 X:12623095-12623117 AAGGGAAGGGAAAGGAAGGGAGG + Intronic
1187025374 X:15429917-15429939 CAGGGTATGTAATGGAAAGATGG - Intronic
1187126340 X:16457690-16457712 GAGGGAGGGAAAAGGAAGGAAGG + Intergenic
1187432838 X:19240474-19240496 GTGGGTAGGTAATGGAAGGAAGG - Intergenic
1187674198 X:21699700-21699722 CAGGGAAGGCAACTGAAGGGAGG - Intergenic
1188220315 X:27533113-27533135 GAAGGAAGGGAAAGGAAGGAAGG + Intergenic
1189144365 X:38640602-38640624 CAGCTTTGGCAAGGGAAGGAAGG - Intronic
1189178708 X:38982955-38982977 GAGAGTGAGCAAAGGAAGGAGGG + Intergenic
1189870738 X:45380789-45380811 CAGGGGACGCAAAGGAGGGAGGG - Intergenic
1190160919 X:48030782-48030804 AAGGGGAGCCAAAGGGAGGAAGG + Intronic
1190281953 X:48936970-48936992 CAGGGTAGGAAGGGGAAGGCAGG - Intronic
1190429938 X:50369526-50369548 CAGGGAGGGGGAAGGAAGGAAGG - Intronic
1190444058 X:50505400-50505422 CATTGTTGGCAAAGGGAGGAGGG + Intergenic
1190472986 X:50801197-50801219 CGTGGTAGGGAAAGGAGGGAAGG + Intronic
1190634210 X:52418494-52418516 AAGGAGAGGCAAAGGAGGGAGGG + Intergenic
1190753354 X:53380818-53380840 TAGGGTAGGGAGAGGAAGGTGGG + Intronic
1191137781 X:57084094-57084116 CAGAGTAGACAAGTGAAGGAAGG + Intergenic
1191707079 X:64104825-64104847 GAAGGAAGGAAAAGGAAGGAAGG + Intergenic
1192033479 X:67539873-67539895 CAGAATATGCAAAGGCAGGAAGG + Intergenic
1192478340 X:71463436-71463458 CAAGGTAGGCAGAGTAGGGATGG + Intronic
1192730497 X:73798491-73798513 GAGGGAAGGGAAAAGAAGGATGG + Intergenic
1192866432 X:75137871-75137893 GAGGGTAGACAATGGGAGGAGGG + Intronic
1193037823 X:76972699-76972721 CAGGGTAGTCCATGGAGGGAAGG - Intergenic
1193203742 X:78723258-78723280 AGAGGTTGGCAAAGGAAGGATGG - Intergenic
1194346444 X:92771859-92771881 CTGGGTATGAAAAGAAAGGAGGG + Intergenic
1196072927 X:111545118-111545140 GAGAGTAGGGAAAGGAGGGAAGG - Intergenic
1197824793 X:130577387-130577409 CAGGTTAGAGAAAGGAAGGAAGG + Intergenic
1198384292 X:136113864-136113886 CCTGGTGGGCAAAGGAAAGAAGG - Intergenic
1198598942 X:138264496-138264518 TTGGGTAGGTAAAGGAAGAAGGG + Intergenic
1198599731 X:138269771-138269793 TTGGGTAGGTAAAGGAAGAAGGG + Intergenic
1199038823 X:143085788-143085810 AAGGGAAGGGAAGGGAAGGAAGG + Intergenic
1199571277 X:149269540-149269562 CAGCTTAGCCAAGGGAAGGATGG + Intergenic
1200043525 X:153387574-153387596 CCGGGTAGGCCAGGGCAGGAGGG + Intergenic
1200066327 X:153505779-153505801 CTGGGGAGGCACAGGAAGGCAGG + Intronic
1200091954 X:153640143-153640165 CAAGGAAGGGACAGGAAGGACGG + Intergenic
1200162203 X:154015336-154015358 CGGGGAAGGGAAAGGAAGGAGGG + Intronic
1200384245 X:155873899-155873921 CAAAGTAGGCAGAGGAAGGAAGG - Intergenic
1200654782 Y:5888508-5888530 CTGGGTATGAAAAGAAAGGAGGG + Intergenic
1201183034 Y:11368055-11368077 AAGGGAAGGGAAAGGAAGAAGGG + Intergenic