ID: 1122718951

View in Genome Browser
Species Human (GRCh38)
Location 14:103711692-103711714
Sequence CCTTCCTGGGAGAGGCTGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 8, 3: 65, 4: 586}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122718951_1122718960 9 Left 1122718951 14:103711692-103711714 CCACCCAGCCTCTCCCAGGAAGG 0: 1
1: 0
2: 8
3: 65
4: 586
Right 1122718960 14:103711724-103711746 GCCATTCCACAGCCCGAGCCTGG 0: 1
1: 0
2: 1
3: 7
4: 215
1122718951_1122718963 19 Left 1122718951 14:103711692-103711714 CCACCCAGCCTCTCCCAGGAAGG 0: 1
1: 0
2: 8
3: 65
4: 586
Right 1122718963 14:103711734-103711756 AGCCCGAGCCTGGCCCAGCAAGG 0: 1
1: 0
2: 2
3: 31
4: 274
1122718951_1122718964 20 Left 1122718951 14:103711692-103711714 CCACCCAGCCTCTCCCAGGAAGG 0: 1
1: 0
2: 8
3: 65
4: 586
Right 1122718964 14:103711735-103711757 GCCCGAGCCTGGCCCAGCAAGGG 0: 1
1: 0
2: 2
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122718951 Original CRISPR CCTTCCTGGGAGAGGCTGGG TGG (reversed) Exonic
900120746 1:1047708-1047730 CCTTCCTGGGAGGCAATGGGTGG + Intronic
900308291 1:2021535-2021557 TCCTCATGGGAAAGGCTGGGTGG + Intronic
900360020 1:2283927-2283949 CCTTCCTGCAGGAGGCGGGGAGG + Intronic
900601080 1:3502885-3502907 CCTCGCTGGGGGAGGCAGGGAGG - Intronic
900616399 1:3567531-3567553 TTGTCCTGGGAGAGCCTGGGGGG - Intronic
900641637 1:3690469-3690491 CCTGCCTGGGGAAGGCTCGGGGG - Intronic
900647175 1:3714280-3714302 GCTTCCTGGGACAGCCTTGGGGG - Intronic
900970145 1:5987539-5987561 CTTTTCTGTGAGAGGTTGGGAGG - Intronic
901082701 1:6592642-6592664 CCTTCCCGGGAGGCCCTGGGAGG - Exonic
901528988 1:9842101-9842123 CCCTCCTCTGAGATGCTGGGAGG - Intergenic
901660935 1:10797234-10797256 CCTTACATGGAGGGGCTGGGGGG + Intergenic
902330721 1:15730040-15730062 CCTACCTGGGCGGGGCGGGGCGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902823831 1:18959205-18959227 CCTTCCTGGAAGAGGTTGCAGGG - Intergenic
902838683 1:19062055-19062077 TGTGGCTGGGAGAGGCTGGGAGG - Intergenic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
902999101 1:20252014-20252036 CATTCCTGGCAGAGGCAGTGTGG - Intergenic
903283862 1:22265097-22265119 ACTTCCTGGGAGAAGGTGAGAGG + Intergenic
903414175 1:23170082-23170104 TCTGGCTGGGAGAAGCTGGGAGG - Intronic
903846535 1:26282507-26282529 TCGTCCTGGTAGAGGGTGGGCGG + Exonic
903868005 1:26412222-26412244 CATTCCTGGGCCAGGCTGGGAGG + Intronic
903910827 1:26723605-26723627 CCTTCCTGGCAGGGGCGGTGTGG + Intronic
904359702 1:29963426-29963448 CCTCCCTGGGAGTGGCAGGAGGG - Intergenic
904396754 1:30227524-30227546 CTTTCCTTGGAAAGGCTGGGAGG - Intergenic
904772582 1:32888648-32888670 CTTTCCTGGGAGAGGGAGGAAGG - Intronic
905238267 1:36565349-36565371 CCTTCCTGGGGGTGGCAGGCAGG + Intergenic
905316397 1:37084229-37084251 GCGCCCTGGGGGAGGCTGGGGGG + Intergenic
905470152 1:38185725-38185747 CCTCCCTGGCAGACACTGGGAGG + Intergenic
905658600 1:39702566-39702588 TCTTCCTGGGAGAGTCTGTGGGG + Intronic
906960398 1:50416357-50416379 CCCTACGAGGAGAGGCTGGGAGG + Intergenic
907243081 1:53091374-53091396 CCTTCCAGGCAGAGGCCCGGGGG - Intronic
907336387 1:53702470-53702492 GCCTCCTGGGAGAGGGTGGCAGG + Intronic
907420257 1:54342375-54342397 CCTCCCTGGGAGGAGATGGGTGG + Intronic
907727729 1:57035455-57035477 CCTTCCTGGGAAAGGAGAGGTGG + Intronic
909293044 1:73908900-73908922 CCTTTTTGGGGCAGGCTGGGGGG - Intergenic
909657268 1:78045888-78045910 CCATCCCGGGGGAGGCTGGGCGG + Exonic
909942757 1:81630256-81630278 CTTTCCTGGAGAAGGCTGGGAGG - Intronic
910365475 1:86460441-86460463 CATTCCTGGTGGAGGGTGGGGGG + Intergenic
911091776 1:94022893-94022915 AGTTCCTGAGGGAGGCTGGGAGG + Intronic
912386754 1:109274634-109274656 AGTTCCTGGGAGAGGCAGTGCGG - Exonic
912392968 1:109317567-109317589 CCTTCCTGGGGGTGGTTGGGCGG + Intronic
912491259 1:110064022-110064044 CCTGGCTGGGAAAGGCTGGCTGG - Intronic
912624194 1:111194308-111194330 TATTCCTGGGACAGCCTGGGTGG - Intronic
912822473 1:112878992-112879014 CCCTGCTCTGAGAGGCTGGGTGG - Intergenic
913058685 1:115185040-115185062 CCATACTGGGAGAAGCAGGGCGG - Intergenic
914196105 1:145448854-145448876 CCAGCAGGGGAGAGGCTGGGAGG - Intergenic
914839523 1:151236715-151236737 CCATCCAGGGAGAGGCTCGACGG + Exonic
916501724 1:165393163-165393185 CCTCCCCTGGGGAGGCTGGGCGG + Intergenic
916745575 1:167682512-167682534 CCCTGCTGGAAGTGGCTGGGAGG + Intronic
919867273 1:201791957-201791979 CATGTCTGGGAGATGCTGGGGGG + Intronic
919939704 1:202277843-202277865 GCTTCCTGGGGGAGGTGGGGTGG + Intronic
920185427 1:204156395-204156417 CCTTCCTGAGTGTGGGTGGGTGG + Intronic
920535250 1:206732883-206732905 CCAGAGTGGGAGAGGCTGGGAGG + Exonic
921219108 1:212960810-212960832 CCGTCCTGGGCCAGGCTCGGTGG + Intronic
922423058 1:225472051-225472073 CCTTCCTTGGAGAGCCACGGTGG - Intergenic
922492020 1:226025531-226025553 CCTTTCTGGGGGTGGCAGGGAGG + Intergenic
923071150 1:230565491-230565513 ACTCACTGGGAGAAGCTGGGAGG + Intergenic
923092476 1:230750838-230750860 ACTGGCTGGGAGGGGCTGGGAGG + Intronic
923335774 1:232968911-232968933 CCTTCCTGGGGAAGGCTGACAGG - Intronic
923624075 1:235599965-235599987 ACTTCCTGGGGTAGGCTGGTGGG - Intronic
923625169 1:235607782-235607804 CCTCCCGGAGAGAGGCAGGGAGG - Intronic
1063357208 10:5412606-5412628 TCTGCCTGGCAGAGGCTGGCGGG + Exonic
1063362709 10:5470598-5470620 CCTCCCTGGCACAGGCTTGGTGG - Intergenic
1063960041 10:11299454-11299476 CCTTCCTGGGGGGGGTTGGGGGG - Intronic
1064017477 10:11783795-11783817 CCGCCCTGCCAGAGGCTGGGCGG - Intergenic
1064030921 10:11882183-11882205 CCTGCCCAGGAGAGACTGGGTGG + Intergenic
1064670013 10:17703706-17703728 CCTATTTGGGAGAGGCTGGAAGG - Intronic
1064705299 10:18066817-18066839 CCTTCTTAGGTGAGGCTGGATGG + Intergenic
1065506714 10:26437031-26437053 CATTCCTGGTAGGGGGTGGGAGG + Intergenic
1066153578 10:32650913-32650935 GGTTCCTGGGAGGGGCTGGCAGG + Intronic
1068685371 10:59865403-59865425 CCTTGCCGGGAAAGGGTGGGAGG - Intronic
1069826394 10:71257504-71257526 CCTTCTTGCCAGGGGCTGGGAGG - Intronic
1070780782 10:79136313-79136335 ACTTCCTGGGACAGGCTGGGGGG - Intronic
1072191068 10:93076418-93076440 CCATGATGGGAGAGACTGGGAGG - Intronic
1072290491 10:93960437-93960459 CCATCCAGGGAGAGGCTCGACGG - Intergenic
1072620240 10:97074826-97074848 CAGCCCTGGGAGAGGATGGGGGG - Intronic
1072706419 10:97684323-97684345 CCATCCTGGGAGAGGTTGTTGGG - Intronic
1072734875 10:97872449-97872471 CTATCCTGGGAGAGGAGGGGAGG + Intronic
1072897139 10:99376764-99376786 CCTCACTGGGAGAGGTTGTGGGG + Intronic
1073023910 10:100471719-100471741 CCTAGCTGTGTGAGGCTGGGTGG + Intronic
1073454864 10:103630283-103630305 GCTTCCTGGCAGAGGCTGCTGGG - Intronic
1074386623 10:113021637-113021659 ACTTCCTGAGAGACCCTGGGGGG - Intronic
1074462186 10:113647885-113647907 CCTTTCTGGGAGTGGATGGATGG - Intronic
1075409848 10:122219278-122219300 AATTCCAGGGAAAGGCTGGGAGG - Intronic
1075651796 10:124132191-124132213 CCTTCCTGGGGGGAGCTGGGAGG + Intergenic
1075784960 10:125042787-125042809 CCCTTCTGGCTGAGGCTGGGAGG + Intronic
1076209814 10:128631288-128631310 CTTACCTGGGCAAGGCTGGGAGG + Intergenic
1076364774 10:129914727-129914749 CCTGCATGGGAGACCCTGGGAGG + Intronic
1076658432 10:132039438-132039460 CCTTACTGGGAAACGGTGGGTGG - Intergenic
1076678355 10:132159519-132159541 TCTTCCTGTGTGATGCTGGGAGG + Intronic
1076678424 10:132159778-132159800 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678453 10:132159879-132159901 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678459 10:132159904-132159926 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678502 10:132160062-132160084 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678514 10:132160115-132160137 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678525 10:132160167-132160189 TCTTCCTGTGTGATGCTGGGTGG + Intronic
1076678557 10:132160272-132160294 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678577 10:132160350-132160372 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678597 10:132160428-132160450 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678636 10:132160557-132160579 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678642 10:132160582-132160604 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678693 10:132160742-132160764 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678699 10:132160767-132160789 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678742 10:132160927-132160949 TCTTCCTGTGTGATGCTGGGTGG + Intronic
1076678786 10:132161084-132161106 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678806 10:132161162-132161184 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678866 10:132161369-132161391 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678894 10:132161475-132161497 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076678901 10:132161501-132161523 TCTTCCTGTGTGATGCTGGGGGG + Intronic
1076727890 10:132421829-132421851 CCTTCCTGGGTGTGGCTGGGGGG + Intergenic
1076847637 10:133077108-133077130 CCTTCCTGGGCTGGGCTGGGTGG - Intronic
1076859613 10:133134467-133134489 CCTGTCTGGGAGAGGCTGGGGGG - Intergenic
1076864467 10:133160203-133160225 CCTTCCTGGGGGAGGCACCGGGG - Intergenic
1076900351 10:133334878-133334900 CCTTTCTGGAAGAGGCCGTGCGG + Intronic
1076928386 10:133507778-133507800 CCTTCCAGGGAGAAACTGGAAGG - Intergenic
1077108878 11:853435-853457 CCTACCTGGGAGGGGAAGGGAGG + Intronic
1077212948 11:1382000-1382022 CCTTGCTGGGGGTGGCAGGGGGG - Intergenic
1077539396 11:3139476-3139498 CCATTCTGGGAAAGGCAGGGAGG + Intronic
1077998463 11:7474124-7474146 CCTTCCTGAAAGTGGCTGAGGGG + Intergenic
1078263746 11:9737195-9737217 CCTTCCTGGGAGGGGCAGGCTGG - Intronic
1079108261 11:17588115-17588137 CCTTCATAGGAGAGGCTGACTGG + Intronic
1080898770 11:36467768-36467790 CATACCTGGGAGGGGCGGGGTGG - Intergenic
1081669863 11:44936928-44936950 CCCGCTTGGGAGAGGGTGGGGGG + Intronic
1081672430 11:44949688-44949710 CCTACCCGGGGGAGGCTGTGTGG - Intronic
1083141427 11:60724958-60724980 CCATCCTTGGAGGTGCTGGGAGG + Intergenic
1083655086 11:64225726-64225748 GCTCCCTGGGAGTTGCTGGGGGG - Intronic
1083721792 11:64607142-64607164 CCCTCCTGGGAGGGCCCGGGAGG - Exonic
1083898409 11:65631933-65631955 CTTGCCTAGGAGTGGCTGGGAGG - Intronic
1084446030 11:69204280-69204302 CCTCCCTGAGAGGTGCTGGGTGG - Intergenic
1084480637 11:69417890-69417912 TCTGCCTGGGAGAGGCGGGGAGG + Intergenic
1084517431 11:69644396-69644418 CCAGCCTGGGAGAGGCCAGGAGG - Intronic
1084540376 11:69782607-69782629 CCATCCAGGGAGAGGGAGGGGGG - Intergenic
1084709004 11:70832474-70832496 CCTGCCTTTGAGAAGCTGGGAGG - Intronic
1084740688 11:71137630-71137652 CCTTCCAGGGAGTGGGTGGCGGG - Intronic
1084919884 11:72460336-72460358 CCTTGCTGAGAGAGGAGGGGGGG + Intergenic
1085332532 11:75666091-75666113 CCTTCCTGCAAGAGGGTGTGGGG - Intronic
1087182147 11:95151258-95151280 CCTCCCCGGGAAAGGCTGGGCGG + Intergenic
1088511454 11:110579891-110579913 CCTTCTTTGTATAGGCTGGGCGG + Exonic
1088685129 11:112278870-112278892 GCTTCCTGGGAGAGTCAGGAAGG - Intergenic
1088817504 11:113431896-113431918 CCTGCCTGGGGCAGCCTGGGTGG - Intronic
1088847596 11:113681375-113681397 CCTGCCTGGGTGGGCCTGGGTGG - Intergenic
1088939590 11:114439744-114439766 CCGTCCTGGGAGAGCGTTGGGGG + Intronic
1089258258 11:117205565-117205587 ACTTCGGGGTAGAGGCTGGGAGG - Exonic
1089586663 11:119513799-119513821 CCCTCCTGGGGGAGGAGGGGTGG + Intergenic
1089773060 11:120816942-120816964 ACGGCCTGGGAGAGGCTGGGAGG - Intronic
1090076306 11:123581985-123582007 CCTTCGTGTAAGACGCTGGGAGG - Intronic
1090382434 11:126336796-126336818 CCTTCCTGGGAGGGGTCTGGAGG - Intronic
1090846106 11:130531285-130531307 CCTCTCTGGGTGAGGCAGGGCGG - Intergenic
1091230933 11:133987534-133987556 CCTCATCGGGAGAGGCTGGGTGG + Intergenic
1091553389 12:1553879-1553901 GCCTGCTTGGAGAGGCTGGGAGG - Intronic
1091660653 12:2380820-2380842 CCTGCTTGGGAGTGGGTGGGGGG + Intronic
1091979473 12:4853668-4853690 CTTTCCTAGGAGTGGCTAGGTGG - Intergenic
1092277252 12:7070663-7070685 CCACCCTTGGAGAGGCTGGTGGG - Exonic
1093498616 12:19784353-19784375 CCTTCACGGGAGAGGCGGGGAGG - Intergenic
1093655315 12:21687788-21687810 GCATGCTGGGAGAGACTGGGAGG - Intronic
1095529628 12:43171310-43171332 CCTTCGTGGGAGTGCCTGGGAGG - Intergenic
1095981484 12:47977050-47977072 CCCACCAGGGATAGGCTGGGAGG - Intronic
1096781670 12:53995620-53995642 CCAGCCTGGGAGTGGCTGGAGGG - Intronic
1096808498 12:54155211-54155233 CCCTCCTTGGAGCAGCTGGGAGG - Intergenic
1098169790 12:67735964-67735986 CCTCTCTGGGCGAGGTTGGGAGG + Intergenic
1098309709 12:69136222-69136244 CCACCCTGGGAGAGGCAGGAAGG + Intergenic
1100505745 12:95218161-95218183 CCTTCCTGGGAATGGATGTGCGG + Intronic
1101298935 12:103457770-103457792 CCCTCCTGGCAGGGGGTGGGGGG + Intronic
1101441592 12:104708322-104708344 CCTTCCCGGGGGCGGCTGTGGGG + Intronic
1101592822 12:106138997-106139019 CCTCCCGGGGAGGGGTTGGGGGG - Exonic
1102517302 12:113458414-113458436 AGTTCCTGAGAAAGGCTGGGTGG - Intergenic
1103727266 12:123004340-123004362 CCTTCCTGGGCGAGGTGGGGAGG - Intronic
1103946643 12:124531052-124531074 CTTCCCTGGGAGAGGCGGGTTGG - Intronic
1104013557 12:124948271-124948293 CCCTCCTGGGTGGGGCTGGTGGG - Intronic
1104190747 12:126479942-126479964 GCTTCCAGGGAGGGGCAGGGAGG - Intergenic
1104759096 12:131286469-131286491 GCTTCCTGGGAGAGGCGGGCAGG + Intergenic
1104773338 12:131378529-131378551 GCTTCCTGGGAAGGGATGGGCGG - Intergenic
1104821514 12:131680027-131680049 GCTTCCTGGGAGAGGCGGGCAGG - Intergenic
1104846294 12:131848757-131848779 CCTTCCTGGCTGAGGCTGAGCGG + Intronic
1105407674 13:20145460-20145482 CCCTCCTGGGGGTGACTGGGTGG - Intronic
1107430007 13:40332106-40332128 CCTTCCTGGAAGAGGAGAGGTGG - Intergenic
1109015780 13:57011446-57011468 CCTTCCTGAGACAAGCTGGAAGG + Intergenic
1110972455 13:81782176-81782198 GCTACCTGGGAGAGGATAGGAGG + Intergenic
1111392120 13:87609798-87609820 CCTTTGTGGGAGAGGTTAGGAGG - Intergenic
1112883029 13:104133044-104133066 CATTCTGGGGAGTGGCTGGGAGG + Intergenic
1113683384 13:112260805-112260827 CCTTCCCAGGAGCGGCTCGGAGG - Intergenic
1114263383 14:21055841-21055863 ACTTCCTGGGACAGGGTGGTGGG + Intronic
1114269089 14:21090597-21090619 CCTTCCTGCGAAGGACTGGGAGG + Exonic
1114440489 14:22742730-22742752 CCTTCATGGGATAGGCAGGAAGG - Intergenic
1115645992 14:35368848-35368870 TCTTTCTGGCAGAGTCTGGGAGG - Intergenic
1115717926 14:36126335-36126357 CCTTCCTGGGATGGGCTAGGTGG - Intergenic
1115873763 14:37837450-37837472 CATCCCTGGGACAGGTTGGGGGG - Exonic
1116861878 14:50001789-50001811 CCTTCCACGGAGAGGCTGCCGGG + Intronic
1117763539 14:59058217-59058239 ACTTGGTGGGAGAGGTTGGGTGG - Intergenic
1118004233 14:61551376-61551398 CCCTCCTAGGAGAGGCAGGCAGG - Intronic
1118030831 14:61816282-61816304 CAGTCCTGGAAGAGGGTGGGTGG + Intergenic
1118468906 14:66056815-66056837 CCTTCCTCTGGGGGGCTGGGTGG - Intergenic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1119172693 14:72546911-72546933 CTTTCCTGAGAGTGGGTGGGAGG - Intronic
1119261800 14:73242119-73242141 CCTTCCTTGGAGAGACAGTGTGG + Intronic
1119666600 14:76489410-76489432 CCTGCATGGGAGAGGGTGTGTGG - Intronic
1121021282 14:90581641-90581663 TCTAACTGGGAGAGGCTGGGCGG - Intronic
1121325865 14:93019267-93019289 CCTGCCTGGGAGAAACTGTGGGG + Intronic
1121642269 14:95493652-95493674 CCTGCCTGGGAGAAGAGGGGTGG + Intergenic
1121696565 14:95917974-95917996 TCTTCCTGCCAGGGGCTGGGTGG - Intergenic
1122062089 14:99142951-99142973 CCATCCTGAGAAAGGCTTGGTGG + Intergenic
1122477162 14:102018396-102018418 CCTTCCTGGGAGGCGCTGTCAGG + Intronic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1122853549 14:104548948-104548970 CCGAACTGGGAGGGGCTGGGAGG - Intronic
1202904333 14_GL000194v1_random:59780-59802 GCTGCCTGGCAGAGGCTGGATGG + Intergenic
1124053356 15:26219760-26219782 CCTTCCTGGGAGATGCAGTCAGG - Intergenic
1124634687 15:31357526-31357548 CCTGCCTGGGGGAGGGAGGGTGG + Intronic
1125581250 15:40787621-40787643 GCTTCCGGGGAAGGGCTGGGTGG - Intronic
1125718598 15:41834404-41834426 CTTTCCTGGTAGATGCTAGGAGG + Intronic
1128545086 15:68561274-68561296 CGTGCCTGGGAGGAGCTGGGAGG - Intergenic
1129117854 15:73375213-73375235 ACTGCCTGGGCAAGGCTGGGTGG - Intergenic
1129269878 15:74413980-74414002 CCCTGCTGGGGGAAGCTGGGTGG - Intronic
1129626804 15:77209664-77209686 CCTTTCTGTGAGATGCTGAGAGG + Intronic
1129946828 15:79545735-79545757 TTTTCCTGGGAGAGTCAGGGTGG - Intergenic
1130879447 15:88042577-88042599 GGTTCCTGTAAGAGGCTGGGAGG - Intronic
1131558266 15:93417896-93417918 CCCTCCCGGGGCAGGCTGGGAGG + Intergenic
1131667309 15:94584339-94584361 CTGTCCTGGGAGAGGCTGTTTGG + Intergenic
1132437512 15:101821175-101821197 CCTTTCTTGGAGGGGGTGGGAGG + Intergenic
1132481767 16:169859-169881 CCTTCCTGCCAGAGGGTAGGTGG + Intergenic
1132482635 16:174116-174138 CCTTCCTGCCAGAGGGTAGGTGG + Intergenic
1132870296 16:2112772-2112794 CCTTCCTGTGAGTGACTCGGGGG - Exonic
1133024791 16:2983861-2983883 TCTTCCTTGGAGAGTCTGGGCGG - Intergenic
1133071541 16:3249732-3249754 CCTTCCTGGGCGTGGCAGCGGGG + Exonic
1133170379 16:3979271-3979293 CCATCCTGCGAGAGGCATGGGGG + Exonic
1133214749 16:4285122-4285144 CCTGCCAGGGAGATGCTGTGTGG - Intergenic
1133898586 16:9952128-9952150 TCTTTCTGGGTGAGGCTTGGAGG - Intronic
1134717127 16:16362816-16362838 CCTTCCTGTGAGTGACTCGGGGG + Intergenic
1134957625 16:18389343-18389365 CCTTCCTGTGAGTGACTCGGGGG - Intergenic
1135207265 16:20493907-20493929 CCACCTTGGGAGAGGCTGGAAGG + Intergenic
1135211620 16:20529725-20529747 CCACCTTGGGAGAGGCTGGAAGG - Intergenic
1135282525 16:21165032-21165054 CCCTCCTGGGACAGACTGGCTGG + Intronic
1136187266 16:28595746-28595768 GCCACCTGGGAGAGGGTGGGTGG + Intronic
1136189745 16:28608671-28608693 GCCACCTGGGAGAGGGTGGGTGG + Intronic
1136278048 16:29191177-29191199 CCTTCCTGAGAGAGCCTGTGAGG - Intergenic
1136317238 16:29461548-29461570 GCCGCCTGGGAGAGGGTGGGTGG - Intronic
1136376391 16:29867980-29868002 CCTTGCTGGCTGAGGCTGGAGGG - Intergenic
1136431813 16:30200891-30200913 GCCGCCTGGGAGAGGGTGGGTGG - Intronic
1137646999 16:50084232-50084254 ACTTCATGGGAGAGGCAGAGGGG - Exonic
1137669382 16:50270640-50270662 CCTCCCTGGGGGAGCCTGGGTGG + Intronic
1138532963 16:57645247-57645269 CCTCGCTGGGAGAGGCAGAGGGG - Intronic
1139360731 16:66398141-66398163 CCACCCTGGGGCAGGCTGGGGGG + Intronic
1139367755 16:66444159-66444181 CCTGCCTGATAGCGGCTGGGTGG + Intronic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139566603 16:67781369-67781391 CCTGCCTGGGTCAGCCTGGGAGG + Intronic
1139853367 16:69963435-69963457 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1139882336 16:70186344-70186366 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1140370173 16:74409160-74409182 CCTTCCTAGCAGAGGCTGCTGGG + Intronic
1140455989 16:75105898-75105920 CCTTCCTGCAAGAGGCGGGAGGG - Intronic
1140475836 16:75238876-75238898 CCTGCCTTTGGGAGGCTGGGAGG - Intronic
1141316641 16:82968652-82968674 CCTGCCTGGGTGGGGCAGGGAGG - Intronic
1141684329 16:85561747-85561769 CCATCCTGGGAGGGGCTTGCAGG + Intergenic
1141732258 16:85830392-85830414 GCTTCCTGGGAGAGGCAGGCTGG - Intergenic
1141893797 16:86945526-86945548 CCTCCTTGGGAGAGGCAGCGTGG + Intergenic
1142082424 16:88157217-88157239 CCTTCCTGAGAGAGCCTGTGAGG - Intergenic
1142119067 16:88377041-88377063 CCCTCCTGGGAGATGCTGAAGGG - Intergenic
1142412024 16:89921747-89921769 CCTTCCTGGGACAGGCTCAATGG + Intronic
1142903874 17:3029671-3029693 CCTTCCTGGAAGCTGCTGGCTGG - Intronic
1142957076 17:3529563-3529585 CCTTCCTGGAGGAGGCTAGAGGG - Intronic
1143016296 17:3892848-3892870 CCTGCAAGGGAGAGGCGGGGGGG - Intronic
1143300868 17:5909852-5909874 ACTTTCTGGGAGTGGCTGGCTGG - Intronic
1143492782 17:7294031-7294053 CCTTCCTGGGAGAGAGGGCGGGG - Intronic
1143609776 17:8011425-8011447 CTTTGCTGGGAGAGCCAGGGAGG - Intronic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1144038164 17:11385730-11385752 CCCAACAGGGAGAGGCTGGGGGG + Intronic
1144761123 17:17708072-17708094 CATTCCTTGGAGATGGTGGGTGG - Intronic
1145031351 17:19507496-19507518 CCTGGCTGGGGGCGGCTGGGCGG - Intronic
1145146113 17:20481168-20481190 CCCTACTGGGAGGGGCGGGGGGG - Intergenic
1146066686 17:29641372-29641394 CCTGCCTGGAAGGGGGTGGGAGG - Intronic
1146789629 17:35744018-35744040 CTTTCCTGGAAGTGGCTGGTGGG - Intronic
1146891763 17:36510903-36510925 CCGTCCTGACAGAGTCTGGGAGG + Exonic
1146926958 17:36751827-36751849 CCATTCTGGGAGAGGCGGGGTGG + Intergenic
1146948775 17:36891609-36891631 CCAGCCAGGGAGAGGTTGGGAGG - Intergenic
1147332196 17:39705688-39705710 GATTGCTGGGAGAGGCTGGTAGG - Intronic
1147585455 17:41651684-41651706 CATTCCTGGGTGAGGGAGGGTGG + Intergenic
1147684226 17:42277023-42277045 CCTTCCTGGGAAAATCTGGCTGG + Intergenic
1147954181 17:44123270-44123292 CCTGTCTGGGAGGGGCAGGGAGG + Intronic
1147972594 17:44227640-44227662 CCTTTCTGGGAGAGGAGGGGTGG - Intergenic
1148034112 17:44645388-44645410 CTTTCCTAGAAGATGCTGGGAGG - Intergenic
1148813241 17:50308271-50308293 CCTTCCTGGTAGATGGGGGGAGG - Intergenic
1148847701 17:50538889-50538911 CGTCCCTGTGGGAGGCTGGGGGG - Exonic
1149624394 17:58069846-58069868 CCTTCCTGCTAGAGGCTGAGTGG + Intergenic
1149751778 17:59153620-59153642 TCTTCCTTGGAAAGGATGGGTGG - Intronic
1149774496 17:59346517-59346539 CCTTGCTTGGAGAGGGAGGGAGG + Intronic
1150286847 17:63959513-63959535 ACCTCCTGGCAGAGGCTGCGGGG + Intronic
1150816571 17:68396688-68396710 GTTTGCTGGGGGAGGCTGGGTGG - Intronic
1150984949 17:70185412-70185434 CCTCCCTGGAAAAGGCAGGGAGG - Intergenic
1151139294 17:71976220-71976242 AGTTCCAGGGAGAGGCTGGGAGG + Intergenic
1151624948 17:75270837-75270859 TCTCCCTGGGACAGGCTGGTCGG + Intronic
1151670968 17:75571560-75571582 CCCTCCTGGGAGAGGCTGGAAGG - Intronic
1151671726 17:75574701-75574723 CCGTGCTGGGAAGGGCTGGGAGG + Intronic
1151785105 17:76271612-76271634 GCTTCCTGGGAGGGCCTGGGGGG - Intergenic
1151814447 17:76464532-76464554 CCATCATGGGTGAGGCAGGGTGG + Intronic
1151969885 17:77452111-77452133 CGTTCCTGGGAGGAGCGGGGAGG + Intronic
1151972827 17:77467589-77467611 GCTTCCTGGGACAGCCGGGGTGG - Intronic
1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG + Intronic
1152117461 17:78397408-78397430 CCTTCCTAGGAGAGGCAGAAAGG - Intronic
1152272497 17:79333152-79333174 CCTCCCTGGTAAAGGCTGGCAGG - Intronic
1152554729 17:81047106-81047128 CCCTCCTGGGAGAGGCCAGGTGG + Intronic
1153659553 18:7314923-7314945 CTCTCCTTGGAGAAGCTGGGAGG - Intergenic
1153774044 18:8437338-8437360 CCCTGCTGGGAGAGGGTGGAGGG - Intergenic
1156651581 18:39232995-39233017 CCCTCCTGGGAGAGGTTGAGTGG - Intergenic
1157113962 18:44845814-44845836 CCTGCCTGGGGGATGGTGGGAGG + Intronic
1157487367 18:48097933-48097955 GCCTGCTGAGAGAGGCTGGGTGG - Intronic
1157584638 18:48793241-48793263 CCTGCCAGGGAGAAGCAGGGAGG + Intronic
1158602602 18:58867568-58867590 CCTTCCTGGGAGAGCCAGGGGGG + Intronic
1159030283 18:63223634-63223656 CCAGCCTGGGACAGGCAGGGCGG + Intronic
1160798556 19:956742-956764 CCTTCCGGGAAGGGGCTGGGGGG - Intronic
1160803040 19:979388-979410 CCATCCTGGCCGAGGCTGGCCGG + Intergenic
1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG + Intronic
1160943778 19:1631879-1631901 CCGTCCTGGGAGCAGCTGCGGGG - Intronic
1161057640 19:2198593-2198615 CCATCCTGAGAGACGCTGGGTGG + Intronic
1161644655 19:5445658-5445680 CCCTCCTGGGCCTGGCTGGGAGG + Intergenic
1161724001 19:5918118-5918140 CCTTTCGGGGAGAGGCCGGCAGG - Intronic
1161743024 19:6036191-6036213 CCCGCCTGGGATTGGCTGGGTGG - Intronic
1161785052 19:6319362-6319384 CCCGCCTGGCAGAGCCTGGGTGG - Intronic
1161801888 19:6420961-6420983 TCTTCCTGGAAGAGGCTAGGAGG - Intronic
1162030257 19:7914256-7914278 AGGTCTTGGGAGAGGCTGGGAGG - Exonic
1162911730 19:13851366-13851388 CCTTTGTGGGAGCAGCTGGGGGG - Intergenic
1163270695 19:16251721-16251743 CCTTCCTGGGAGATCCAGGAGGG - Intergenic
1163758774 19:19121692-19121714 CCTGCCTGGGGGACCCTGGGAGG + Intronic
1164434648 19:28218975-28218997 GTTTCCTGGGAGAGGCGGGGAGG - Intergenic
1165166873 19:33863246-33863268 CCTTCCTGGGCTAGGCCAGGGGG + Intergenic
1165345791 19:35248360-35248382 CCTGGCTGGGAGAGGCTTGTTGG - Intronic
1165432405 19:35780403-35780425 CCCACCTGGGAGAGGGCGGGTGG - Exonic
1165713330 19:38027467-38027489 CCTTCCTGGGAGATTCCTGGAGG + Intronic
1166128848 19:40733379-40733401 CCTTCCCGGGACAGGCCAGGCGG - Intronic
1166251784 19:41576350-41576372 ACTCCCTGGGAGTGGGTGGGAGG + Intronic
1166255265 19:41599809-41599831 GCTCCCTGGGAGTGGATGGGAGG + Intronic
1166266531 19:41688068-41688090 ACTTCCTGGGAGTGGGTGGGAGG - Intronic
1166270199 19:41708807-41708829 ACAACCTGGGAGAGGGTGGGAGG + Intronic
1166423243 19:42654279-42654301 CCTTCCTGGGAGAGGACGGGAGG + Intronic
1166432629 19:42740287-42740309 ACTTCCTGGGAGAGGACAGGAGG - Intronic
1166445610 19:42855522-42855544 ACTTCCTGGGAGAGGACAGGAGG - Intronic
1166448608 19:42879484-42879506 ACTTCCTGGGAGAGGACAGGAGG - Intronic
1166453007 19:42917695-42917717 ACTTCCTGGGAGAGGACAGGAGG - Intronic
1166465290 19:43026275-43026297 ACTTCCTGGGAGAGGACAGGAGG - Intronic
1166471411 19:43082472-43082494 ACTTCCTGGGAGAGGACAGGAGG - Intronic
1166482555 19:43186308-43186330 ACTTCCTGGGAGAGGACAGGAGG - Intronic
1166485036 19:43205439-43205461 ACTTCCTGGGAGAGGACAGGAGG - Intronic
1166492179 19:43269334-43269356 ACTTCCTGGGAGAGGACAGGGGG - Intronic
1166499660 19:43331311-43331333 ACTCCCTGGGAGAGGGTGGGAGG - Intergenic
1167415570 19:49369673-49369695 CCTTTCTCAGAGTGGCTGGGCGG - Intronic
1167786063 19:51637174-51637196 ATTTCCTGGTAGAGGCTGTGGGG - Intronic
925959637 2:9003399-9003421 CCTTCCAGGGAGCGGCGGGTAGG + Intronic
926136834 2:10342498-10342520 CCAGCCTGGGGGAGGGTGGGAGG + Intronic
926771714 2:16383558-16383580 ACTTCTTGGCAGAGGTTGGGGGG + Intergenic
926987208 2:18638273-18638295 CCTTCCTGGGTGTGTCTGTGAGG + Intergenic
927492497 2:23529798-23529820 CCGTCCTGAGACAGCCTGGGGGG + Intronic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
927886707 2:26723278-26723300 TCTTCCAGGGAGATGCGGGGTGG - Intronic
927922314 2:26982499-26982521 CCTTCCTGGTAGGGACTGGCAGG - Intronic
928093686 2:28391753-28391775 CCTCGCTGGGCGGGGCTGGGAGG - Intergenic
928196392 2:29219485-29219507 CTTTCCTGGGAGCGGGAGGGTGG + Intronic
928272001 2:29864914-29864936 CCTTCAGGGGAGAGGGTGGGAGG - Intronic
929533283 2:42765215-42765237 CATCCCTGGGAGAAGCAGGGTGG + Intergenic
929597798 2:43187118-43187140 CCAGTCTGGGAGAGGCTGCGGGG - Intergenic
929776551 2:44934181-44934203 CCTTCCTGCGAAATGCCGGGTGG - Intergenic
930089599 2:47521856-47521878 CCTCACTGGGCGAGGGTGGGGGG + Intronic
930734134 2:54757802-54757824 CCTACCAGGGCGAGGGTGGGAGG - Intronic
931239550 2:60439801-60439823 CTTTCCTGGCTTAGGCTGGGAGG - Intergenic
932084272 2:68744302-68744324 CCTTCCCAGGACAAGCTGGGTGG - Intronic
932714686 2:74092796-74092818 GCATCGTGGGGGAGGCTGGGAGG - Intronic
933040478 2:77458673-77458695 CCTTCCTTGCAGAGGTTCGGTGG + Intronic
933759617 2:85664761-85664783 CCTATCTGGGAAAGGCTGAGGGG + Intronic
934052329 2:88221165-88221187 CTTTCCTGGGGGTGGCTAGGAGG + Intergenic
935349540 2:102141888-102141910 CCTTGCAGGGAGAGGAGGGGAGG - Intronic
935738583 2:106126540-106126562 CGCTTCTGGGTGAGGCTGGGTGG + Intronic
936057165 2:109269895-109269917 CTTTCCTGGGAGGGGATGAGGGG - Intronic
936534521 2:113301815-113301837 CATTCCTGGGATAGGCAGAGAGG + Intergenic
937287138 2:120760864-120760886 CCTTCTCGGGACAGGCTTGGAGG - Intronic
937906476 2:127055179-127055201 CCTTCATGGTGGAGGCCGGGTGG - Intronic
938260548 2:129892433-129892455 GCTTCCAGGGAGAGGCAGAGTGG + Intergenic
940309372 2:152261318-152261340 ACTTCAGGGGAGAGGGTGGGAGG + Intergenic
943702714 2:191004002-191004024 ACTTGCTGGGAGATGCTTGGTGG + Intronic
944242608 2:197500285-197500307 CCTCCCTGGGAGGGGCGAGGGGG + Exonic
945306689 2:208266061-208266083 CCTTCCTGGAAGAAGCCAGGGGG - Intronic
945516499 2:210768799-210768821 TCTTCCTAGGAGAGGATGTGGGG + Intergenic
945594341 2:211773178-211773200 CCTTGGTAGCAGAGGCTGGGAGG + Intronic
945957032 2:216096011-216096033 CCTTCCTGAGAGAGCCCTGGTGG - Exonic
945990572 2:216392383-216392405 GCTTCCTGGGAGTGGAAGGGAGG + Intergenic
946184790 2:217974393-217974415 CTTTCTGGGGAGAGGCTGAGGGG - Intronic
946225485 2:218262048-218262070 CCTTCCTGGGAGCTGGAGGGAGG - Exonic
946402464 2:219475817-219475839 CCTGTCTGGGTGTGGCTGGGTGG - Intronic
947107379 2:226681654-226681676 CATTTCTGGGAGTGTCTGGGAGG - Intergenic
947807196 2:232976998-232977020 CCTTCCCGGGAGTGCCTGGGAGG + Intronic
948112215 2:235465065-235465087 CTTTCCTGAGAGAGGAGGGGAGG + Intergenic
948182439 2:235992918-235992940 CCTACCTGGGAGAACCTGGCTGG + Intronic
948374376 2:237511854-237511876 CTTTTCAGGGAGAGGGTGGGAGG + Intronic
948385096 2:237576067-237576089 TCTTCCTGGGAGAGTCCCGGAGG - Intronic
948525177 2:238566991-238567013 CCTTCCTGGGAGAGTCCTCGTGG + Intergenic
948656430 2:239479476-239479498 CCCACCTGGGACAGGCTTGGGGG + Intergenic
948788084 2:240363433-240363455 CCAGCCTGGGAGAAGGTGGGGGG - Intergenic
948899672 2:240949927-240949949 CCCTCATGGAAGAGGCTGGAAGG + Intronic
1168818563 20:757746-757768 CCTTCCTGGGAGGGACTGACTGG + Intergenic
1168981702 20:2009529-2009551 CCTACCTATGATAGGCTGGGGGG + Intergenic
1169622895 20:7527733-7527755 CCTTCCTGGGAAGAGGTGGGAGG - Intergenic
1170251840 20:14292145-14292167 CCTTTCTGGGAAAAGTTGGGAGG - Intronic
1171449549 20:25226009-25226031 CCTTCCTGCAAGAGTCTGGGAGG + Exonic
1171473506 20:25390409-25390431 CCACTCTGGGAGGGGCTGGGAGG + Intronic
1172034827 20:32003244-32003266 CCCTCCTGGGGGAAGCTCGGAGG - Exonic
1172117581 20:32581945-32581967 TCTTCCTGGGAGGGGCTGAATGG - Intronic
1172272200 20:33660960-33660982 CCACCCTGAGAGGGGCTGGGAGG - Intronic
1173223187 20:41145994-41146016 CCATCCTGGGGGAGGCAGGGAGG + Intronic
1173941829 20:46917560-46917582 CATTCCTTGGAGATGCTGCGGGG + Intronic
1174041393 20:47702480-47702502 CCAGCCTGGGAGTGGCTGTGTGG - Intronic
1174075433 20:47932200-47932222 TATGCCTGGCAGAGGCTGGGAGG + Intergenic
1174619689 20:51864604-51864626 CCTTCCAGGTAGAGCCTGGGTGG - Intergenic
1174986013 20:55452772-55452794 CCTTCCTGGCAGGGGTTGTGAGG - Intergenic
1175033880 20:55981534-55981556 CCTTCCCTGAAGAGGGTGGGAGG - Intergenic
1175236080 20:57512864-57512886 CCTTCCTGGGCAGGGCAGGGTGG + Intronic
1175482961 20:59324427-59324449 CCTTCCTGAAAGAGGCAGCGGGG - Exonic
1175773318 20:61637192-61637214 CTTTCCTGGGAGAGGGTGCTTGG - Intronic
1175822408 20:61917473-61917495 CCTTCCTGTGGGAGGCTCGCAGG + Intronic
1175988184 20:62774676-62774698 CCTTCCAGGCAGGGGCTGAGGGG + Intergenic
1176030759 20:63010049-63010071 CGTCTCTGGGAGAGGCAGGGTGG - Intergenic
1176065687 20:63193313-63193335 GTTTCCTTGGAGGGGCTGGGTGG - Intergenic
1176141854 20:63548376-63548398 CTGTCCAGGGAGAGGGTGGGAGG - Intronic
1176145722 20:63564578-63564600 ACGTCCTGGCAGAGGCTGGCCGG + Exonic
1176234299 20:64047222-64047244 CTTTCCTGAGGGAGGCTGGCAGG - Intronic
1176287018 21:5023658-5023680 GCTTCCTGGGCCAGGGTGGGGGG - Intronic
1176287803 21:5027964-5027986 TCATCCTGGGAGGGGCTGTGGGG - Exonic
1176867878 21:14063829-14063851 CCTTCCGAGGAGAAGCAGGGCGG + Intergenic
1178432478 21:32528763-32528785 ACTTGCGGGGAAAGGCTGGGAGG + Intergenic
1179131162 21:38638634-38638656 CCTCCCTGCCAGAGGATGGGGGG + Intronic
1179585957 21:42374230-42374252 CCTTGCTGGGAGAGGCAGCCTGG - Intronic
1179869378 21:44235511-44235533 TCATCCTGGGAGGGGCTGTGGGG + Exonic
1179870163 21:44239817-44239839 GCTTCCTGGGCCAGGGTGGGGGG + Intronic
1180043869 21:45293937-45293959 CCCTCCTGGGTGAGACTGGCCGG + Intergenic
1180099355 21:45577249-45577271 CCACCCTGGGAGTGCCTGGGGGG - Intergenic
1180158587 21:45989334-45989356 CCTGCCAGGGAGGGGCTGGGTGG + Intronic
1180163110 21:46006810-46006832 CATGCCTGGCAGGGGCTGGGAGG + Intergenic
1180168015 21:46040120-46040142 GGGTCCTGGGAGAGGCTGGAGGG - Intergenic
1180188576 21:46152061-46152083 CATTCCTGGGTTAGGCTGGAGGG - Intronic
1180844261 22:18972857-18972879 ACTTCCAGGCTGAGGCTGGGCGG + Intergenic
1180871520 22:19149631-19149653 CGCTCCGGGGAAAGGCTGGGCGG + Intronic
1181057210 22:20265854-20265876 ACTTCCAGGCTGAGGCTGGGCGG - Intronic
1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG + Intergenic
1181458240 22:23071305-23071327 CCTTCCTGGGTGATGATGGCAGG + Intronic
1181477188 22:23176000-23176022 CCTGCCTGCGTGAGGCTGGGTGG - Intergenic
1182269543 22:29144872-29144894 ACTTCCTCGGAGGGCCTGGGAGG + Intronic
1182420935 22:30248257-30248279 CCCTGCTGGGAGAGAATGGGGGG - Intergenic
1182490088 22:30665922-30665944 AATTCCAGGGAGGGGCTGGGTGG + Intronic
1183355076 22:37354219-37354241 CCCTCGAGGGAGAGGCTGGCAGG + Intergenic
1183365903 22:37406709-37406731 ACTTCCTGGGGGAGGCTGAGGGG + Intronic
1183582257 22:38733071-38733093 CCTGCCTGGGAAAAGCCGGGGGG - Exonic
1183884679 22:40869029-40869051 CCTTTCTGGGACAGGCTGAAGGG - Exonic
1184150057 22:42632562-42632584 GCTGCCTGGGAGAGGTTGGTGGG - Intronic
1184189422 22:42885105-42885127 CCTTCTTGGGACAATCTGGGAGG - Intronic
1184243488 22:43223561-43223583 GCTTCCTGGGAGGGGCCGTGGGG + Intronic
1184387216 22:44182967-44182989 CCTGTCTGGGATAGGGTGGGGGG + Intronic
1184525292 22:45019213-45019235 CCTTCCCGATAGAGGGTGGGAGG - Intergenic
1184656448 22:45944317-45944339 CCTTCCTGGGGGTGGCATGGAGG - Intronic
1184756599 22:46519596-46519618 CCTTCCTGGGCGGGGTTGGGAGG + Intronic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
1185116129 22:48939460-48939482 CCGCCCTGGGAGAGGCTGGCAGG - Intergenic
1185130407 22:49035589-49035611 GCTTCCTGGGTGAGGCTTGCTGG + Intergenic
1185193857 22:49455893-49455915 GCTGTCTGGGAGGGGCTGGGAGG + Intronic
949540274 3:5026898-5026920 CCTCCCTGGGACAGCCTGGGTGG + Intergenic
950523982 3:13513043-13513065 CCTGGCTGGGAGAGCCTTGGGGG - Intergenic
950563329 3:13748790-13748812 CTTTCCTGGGGGTGGCTGGCAGG + Intergenic
950718433 3:14865834-14865856 CCTTCTTGGGAGAGGAGGAGTGG - Intronic
951202461 3:19890429-19890451 CAGTCCTGGGAGAGGATGGTAGG + Intronic
951962438 3:28343435-28343457 CCTTCCTGGTAGAGGCACTGTGG + Intronic
953126078 3:40092974-40092996 GCTCCCTGGGAGATTCTGGGAGG - Intronic
953412670 3:42698993-42699015 GCTGGCAGGGAGAGGCTGGGTGG + Intronic
953686632 3:45083104-45083126 CCTGCTTGGAAGGGGCTGGGAGG + Exonic
953901825 3:46847844-46847866 CCAACCCGGCAGAGGCTGGGAGG + Intergenic
953982325 3:47418950-47418972 CCATGCTGGGAGAGTCTGGCCGG - Intronic
954527419 3:51284337-51284359 CCTTCCAGGGAGAAACAGGGAGG - Intronic
954629407 3:52039977-52039999 CCTTCCCGGGCCCGGCTGGGTGG + Intergenic
956863857 3:73350560-73350582 CCTTTCTGGGTGACTCTGGGAGG + Intergenic
958482308 3:94658358-94658380 CCTGCCTTGGAGTAGCTGGGAGG - Intergenic
961445367 3:126978145-126978167 CCCACCTGGGAGACCCTGGGTGG - Intergenic
961456273 3:127026083-127026105 CATTCCTGAGTGGGGCTGGGAGG + Intronic
961812908 3:129532001-129532023 GCATGCAGGGAGAGGCTGGGTGG + Intronic
962635781 3:137330126-137330148 TCTGCATGGGAGAGGCTGGGAGG - Intergenic
965734398 3:171805493-171805515 GGATCCTGGGAGAGTCTGGGAGG - Intronic
966382328 3:179356240-179356262 CCTTCCTGGAAATGGGTGGGTGG - Intronic
966734644 3:183179315-183179337 CATTCCCGGGAGAGGCGGTGTGG - Exonic
967429371 3:189363901-189363923 CTTACTTGGGAGAGGTTGGGGGG - Intergenic
967857804 3:194131441-194131463 CCTTCCGGGGCGGGGGTGGGGGG + Intergenic
967970259 3:194994210-194994232 CCTCCGTGAGAGGGGCTGGGAGG - Intergenic
968065131 3:195754255-195754277 CGTTCCTGGGAAGGGCTGCGAGG - Exonic
968601769 4:1513037-1513059 CCCTCCTGGGCGGTGCTGGGCGG - Intergenic
968707449 4:2086757-2086779 CCTTCCTGGGGGAGCATGGCCGG + Intronic
968808305 4:2788803-2788825 ACTCCCTGGGGGAGGCTGTGTGG - Intergenic
969345026 4:6564694-6564716 CCTTCCTGGGAGGGGAGGGTAGG - Intergenic
969685538 4:8672054-8672076 AGTTCCTGGGAGTGGCTGGAGGG + Intergenic
970131301 4:12874934-12874956 CCTTCCTGGGCCTGGCTGAGTGG + Intergenic
971837971 4:31793779-31793801 CCTTTCTGGTAGGGGGTGGGTGG - Intergenic
973741044 4:53919798-53919820 GCTTGCTGGGAGAGGCGGGGTGG + Intronic
974047214 4:56908188-56908210 CCTTCCTCGGTGAGGAGGGGCGG - Exonic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
979294779 4:119019056-119019078 ACTTGATGGGGGAGGCTGGGAGG + Intronic
980795884 4:137681929-137681951 CCAGCCTGGGAGAGGTGGGGTGG + Intergenic
980807456 4:137831821-137831843 CCTTCCTGGCAGAGTCTGCCAGG + Intergenic
982079282 4:151771933-151771955 CCTGCCTGAGAGAGGCTGAAGGG - Intergenic
983043677 4:162959482-162959504 ACTTCTTGGGTGAGGCTTGGTGG - Intergenic
983780382 4:171663230-171663252 TCTTCCTGTGAGTGCCTGGGAGG - Intergenic
985654255 5:1121787-1121809 CCTTCCTAGGAGAAACTGCGCGG - Intergenic
985902011 5:2803918-2803940 TCCTCCTCTGAGAGGCTGGGAGG + Intergenic
985972285 5:3388035-3388057 CCTCCCTTGGAGAGGCTGGCAGG + Intergenic
990186140 5:53212142-53212164 GCCTCCTGGGAGGGTCTGGGGGG - Intergenic
990447076 5:55903360-55903382 CCTTCCTTGAAGAAGCAGGGAGG - Intronic
990484822 5:56247835-56247857 CCTTCCTGGCAGACTCTGGAGGG + Intergenic
991474430 5:67004334-67004356 CCTTCCAGGGTCCGGCTGGGAGG - Intronic
991594482 5:68288617-68288639 CCTGCCGGGAACAGGCTGGGGGG + Intronic
991952749 5:71962675-71962697 GCTTCTTGGGAGAGGGTAGGAGG + Intergenic
992546254 5:77816873-77816895 CCTTCCTGGCAGTGGCAGAGGGG - Intronic
992838520 5:80664388-80664410 CCCTCCAGGCAGAAGCTGGGAGG - Intronic
993955628 5:94228951-94228973 TCATCCTTGGAGTGGCTGGGTGG - Intronic
994099760 5:95879972-95879994 TCATCCTGGGAAATGCTGGGTGG + Intergenic
994796539 5:104307841-104307863 CCTTCAGGGCAGAGGCTTGGCGG - Intergenic
997021130 5:130002827-130002849 CCTTTTTGGGAGGGGCTGGAGGG + Intronic
997615025 5:135240314-135240336 GCTTCCTGGAGGAGGCTGGGTGG + Intronic
997618981 5:135272599-135272621 CCTGCATGGGAGTGGCGGGGAGG + Intronic
997888795 5:137657183-137657205 CCTTCCTGGAAGAAGCAGGCAGG + Intronic
998504365 5:142660276-142660298 CCTTCCAGTCAGAGGCTGAGTGG - Intronic
999181841 5:149675371-149675393 CCTTCCTTGGAGAGGCTGATAGG - Intergenic
1001197554 5:169687007-169687029 TCTTCCTGGGTGAGGATGGATGG + Intronic
1001866185 5:175107646-175107668 CATCCCTGGGAGATGCTGGCAGG + Intergenic
1001927927 5:175652604-175652626 CGTTCATGGGAAGGGCTGGGAGG - Intergenic
1002661352 5:180792811-180792833 ACTTCCCGGGTGAGGCTGGCGGG + Exonic
1002762853 6:215162-215184 CCCTCCTGGGTGATGCTGTGAGG + Intergenic
1003555606 6:7137178-7137200 CTTTCCTGGGAAGGCCTGGGTGG + Intronic
1004253795 6:14044336-14044358 CTGTCCAGGGAGAAGCTGGGAGG - Intergenic
1006514690 6:34539382-34539404 CCTCACTGGTCGAGGCTGGGTGG + Exonic
1007251738 6:40500015-40500037 CCTGCCACGGAGAGGATGGGAGG - Intronic
1007738977 6:43999778-43999800 TCTTCCTGGGGAAGGATGGGAGG - Intergenic
1007818141 6:44539288-44539310 CTTTCCTGGGAGAGGAGGGGAGG - Intergenic
1011340455 6:86307723-86307745 GCTTCTTGGTGGAGGCTGGGGGG - Intergenic
1012547435 6:100435591-100435613 TCTGTCTGGGAGAGACTGGGAGG - Intronic
1013184978 6:107749679-107749701 CCTACCTGTGAGAGCCTGTGGGG + Exonic
1013368434 6:109451565-109451587 CCTGGCCAGGAGAGGCTGGGTGG - Intronic
1013480683 6:110550395-110550417 CCTTCCCGGGAGAGCCAGGTGGG + Intergenic
1016004092 6:139071561-139071583 CCTTCCTGGGCCAGGCACGGTGG + Intergenic
1017907895 6:158769362-158769384 CCCTCCTGGAAGAGGCGCGGAGG - Exonic
1018021558 6:159765902-159765924 CCTTCCTTGGAGAGTTTGTGGGG - Intronic
1018144917 6:160877079-160877101 CCTACCTAGGAGGGGCTGGCAGG - Intergenic
1018448771 6:163885452-163885474 ACTTCCTGGGAAAGGCTGTGTGG - Intergenic
1019224347 6:170498060-170498082 CCTCTCTGGGAGACTCTGGGAGG - Intergenic
1019696791 7:2450791-2450813 GGTGCCTGGGAGAGGGTGGGGGG - Intergenic
1020023946 7:4885343-4885365 CCTTCCTGGGGTAGGCGAGGAGG - Intergenic
1020026936 7:4905955-4905977 CCGTGCTGGGAGATGCTGTGTGG - Intergenic
1020029520 7:4923058-4923080 CATACCTGGGAGAAGCTGTGAGG - Intronic
1020756653 7:12211459-12211481 CCTTCCGGAGCGAGGCTGAGCGG + Intronic
1021634396 7:22677311-22677333 GCTTCCTGAGAAAGGCTGTGTGG + Intergenic
1022502596 7:30892140-30892162 CCTTCATGGAAGGGGCAGGGAGG - Exonic
1023116132 7:36864436-36864458 GCTGCCTGGGAGGGGGTGGGAGG + Intronic
1023481183 7:40636358-40636380 GCTTCCAGGGAGAGGTGGGGAGG + Intronic
1023682669 7:42703448-42703470 CCTTCCTGGAAGAGGCAAGGAGG + Intergenic
1025898201 7:65723215-65723237 CCCTCCTGCAAGAGGCTGAGTGG - Intergenic
1025928832 7:65979649-65979671 TCTTCCTGGTAGGGACTGGGTGG - Intronic
1026766321 7:73162092-73162114 CCTACCTGGGACAGGCCTGGAGG + Intergenic
1026847470 7:73705983-73706005 CCTGCCTGAGAGAAGCTGGATGG + Intronic
1027042794 7:74971788-74971810 CCTACCTGGGACAGGCCTGGAGG + Intronic
1027080848 7:75230569-75230591 CCTACCTGGGACAGGCCTGGAGG - Intergenic
1027151009 7:75733640-75733662 GCTTCCTGGAGGAGGCTGGCAGG + Intronic
1027907694 7:84207266-84207288 GGTTCCTGGGAGATGCAGGGTGG + Intronic
1028248525 7:88512166-88512188 CTGTCCTGGGAGGGGCGGGGGGG + Intergenic
1029545831 7:101210157-101210179 CAGTCCTGTGAGAGGGTGGGGGG + Exonic
1029595821 7:101537217-101537239 TATTCCTGGGACAGGCTGGCAGG + Intronic
1032002050 7:128271831-128271853 CTTTTCTGGGAGACACTGGGCGG - Intergenic
1032415202 7:131730162-131730184 GTTTTCTGGGAGGGGCTGGGGGG + Intergenic
1034268117 7:149790954-149790976 CCAGCCTGGGAGGAGCTGGGGGG - Intergenic
1034533592 7:151712793-151712815 CTTTCCTGGGAGAGGTTCTGAGG + Intronic
1034567702 7:151928892-151928914 GCTTCCTGGGAGCTGCTAGGAGG - Intergenic
1034627368 7:152503703-152503725 CCTGCCAGGGGGAGGCAGGGAGG + Intergenic
1034940045 7:155224791-155224813 CCATCCAGGGAGGGGCTGGGAGG + Intergenic
1035264704 7:157684620-157684642 TCTTTCTGGAAGAGGCTGTGTGG - Intronic
1035582875 8:751061-751083 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582885 8:751101-751123 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582895 8:751141-751163 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582905 8:751181-751203 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582915 8:751221-751243 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582925 8:751261-751283 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038492675 8:27981906-27981928 ATTTCCTGGGAGGGGCTGGCTGG - Intronic
1039154519 8:34540418-34540440 ACTTCCTGGGTGAGGGAGGGGGG - Intergenic
1039492103 8:37955617-37955639 CCTTCCTCGGCCAGGCTTGGTGG + Intergenic
1039870219 8:41539735-41539757 TCTTCCGGCGAGAGGCTGGAAGG - Exonic
1039885672 8:41652879-41652901 CCTTCCTAGGGAATGCTGGGGGG + Intergenic
1039957813 8:42220747-42220769 CTTTTCTGGGAAGGGCTGGGTGG + Intergenic
1040097628 8:43462049-43462071 CCTTCATGAGAAAGCCTGGGTGG - Intergenic
1040329968 8:46380919-46380941 CCTTCCTGGGTCAGCCCGGGGGG - Intergenic
1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG + Intergenic
1041249639 8:55921718-55921740 CCAGCCTGGGAGAGGCAGGGAGG + Intronic
1041327382 8:56682710-56682732 CCTTGGTGGGTGAGGCGGGGAGG + Intergenic
1042790723 8:72602770-72602792 CCTTCATGAGAGTGGCTGGAAGG + Intronic
1045547572 8:103141527-103141549 CCTGCCTGGGATCGCCTGGGTGG + Intronic
1047585587 8:126268712-126268734 GCTGGCTGGGAGAGGCTGGCTGG - Intergenic
1047957072 8:129984310-129984332 CCTGCCTGGGAGACACTGGATGG - Intronic
1048008550 8:130438566-130438588 CCTTCCTGGGAGAGGACTTGGGG + Intronic
1049107886 8:140624987-140625009 CCTTCCTGGAGGAGGCTGCTGGG - Intronic
1049302732 8:141880260-141880282 CCTCCCTGGAAGGGGGTGGGAGG - Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049373457 8:142278450-142278472 CCTTCCTGGGAGCTGCTGGAAGG - Intronic
1049414976 8:142490999-142491021 CATCCCTGGGAGGGGGTGGGAGG - Intronic
1049584279 8:143425753-143425775 CCTTCCTGGAGGAGGCTGCCTGG - Intronic
1049705762 8:144041243-144041265 CTGGCCTGGGAGAGGCTGGTGGG + Exonic
1049740791 8:144239962-144239984 GCTTCCTGGGAGCAGGTGGGGGG + Intronic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1049852961 8:144843968-144843990 CCTTCCTCAGAGAGGCAGGCTGG + Intronic
1052860474 9:33435015-33435037 TCTGTTTGGGAGAGGCTGGGGGG - Intergenic
1052956243 9:34255202-34255224 GCTACCCAGGAGAGGCTGGGAGG - Intronic
1053292832 9:36893342-36893364 CCAGCCTGGGAGAGGCCTGGTGG - Intronic
1055030885 9:71770220-71770242 CCCTTCTGGGATAGGCAGGGAGG + Intronic
1055667382 9:78566343-78566365 GCCTCCGGGGAGAGGCTGTGAGG + Intergenic
1056765092 9:89440231-89440253 GCTTCCTGGCAGGGGCGGGGAGG - Intronic
1056803324 9:89709111-89709133 CCATGCTAGGAGAGGCTGAGTGG - Intergenic
1057221936 9:93262120-93262142 CAGTCATGGGACAGGCTGGGGGG - Intronic
1057443079 9:95096039-95096061 CCTGCTTCGGAGAGGCAGGGAGG - Intergenic
1057829789 9:98397708-98397730 GCTTCCTGGAAGAGGCAGGTAGG - Intronic
1058677172 9:107410200-107410222 CAGTCCAGGGAGAGGCTGGCTGG + Intergenic
1058938636 9:109792525-109792547 CCTTCCTGGGAGACTTTTGGGGG - Intronic
1059518351 9:114916512-114916534 TCTTCCTTGGAAAGTCTGGGTGG + Intronic
1059656866 9:116365334-116365356 CCTTCCCGGGAGGCGCGGGGAGG - Intronic
1060029825 9:120204719-120204741 ACTTCCTGGGAGAGGCTTAAGGG + Intergenic
1060047520 9:120352299-120352321 TGTTCCTGGGAGAGGCTGAGAGG - Intergenic
1060111543 9:120910107-120910129 CCCTTCTGGGAGAGGCTGACTGG + Intronic
1060243563 9:121925596-121925618 CCTTCCTGGGAGGGTCTGGAGGG - Intronic
1060403213 9:123360397-123360419 CCTTCCCGGGCCAGGCTGGAGGG - Intronic
1060406580 9:123375892-123375914 CCTTCCTGGGGCGGGGTGGGGGG + Intronic
1060934779 9:127508587-127508609 CCTTCCTGGGTGCCGCTGAGGGG + Intronic
1061003872 9:127917308-127917330 CCTGCCTGGGCGAGGCTGTCGGG + Intergenic
1061425188 9:130494063-130494085 CCTTTCTGGGTGAGGAAGGGAGG - Intronic
1061729621 9:132603743-132603765 TCGTCCCGGGAGAGGCTGGCTGG + Intronic
1061804214 9:133129091-133129113 TCTGCCGGGGAGGGGCTGGGTGG - Intronic
1061938936 9:133873844-133873866 CCTGCCTGGAAGTTGCTGGGTGG - Intronic
1061972903 9:134054363-134054385 CCCTCCTGGGACACGCAGGGTGG - Intronic
1061982036 9:134111197-134111219 CGTTCCTGGGAGTGTCTGTGAGG + Intergenic
1062049237 9:134438585-134438607 GCTTCCTGGCAGTGCCTGGGAGG - Intronic
1062189586 9:135241036-135241058 CAGGCCTGGGAGAGGCTGTGAGG + Intergenic
1062193513 9:135259681-135259703 CTTCCCCAGGAGAGGCTGGGTGG + Intergenic
1062250837 9:135592733-135592755 CCTTCCTGGGAGGGACAAGGAGG + Intergenic
1062530209 9:136996381-136996403 CCTTCCTGTGGGTGGCTAGGGGG - Intronic
1062590424 9:137272205-137272227 CCTACCTTGGAGAGGCGGTGAGG - Exonic
1062698627 9:137887981-137888003 CCAGCAGGGGAGAGGCTGGGAGG + Intronic
1203563219 Un_KI270744v1:74505-74527 GCTGCCTGGCAGAGGCTGGATGG - Intergenic
1185488400 X:500168-500190 GCTTCCCGGGAGCGTCTGGGAGG - Intergenic
1186530421 X:10289914-10289936 GCTTTCTGGAAGAGACTGGGTGG - Intergenic
1187139421 X:16578194-16578216 GCTTCATGGGAGTGTCTGGGGGG + Intergenic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1189298496 X:39935788-39935810 TCTTCCTGGGAGGGCCTGGCTGG - Intergenic
1189389458 X:40563852-40563874 CCTTCCTTGGAGAGCCTTTGGGG - Intergenic
1189890384 X:45595502-45595524 TCTTCCTGGGCTAGGGTGGGGGG + Intergenic
1190379327 X:49823978-49824000 TCTTCCTGAGTGAGGCTTGGTGG - Intergenic
1190490644 X:50979480-50979502 CCTTCCTGGGAGGGCCGGTGGGG - Intergenic
1190845066 X:54183414-54183436 CGGACCCGGGAGAGGCTGGGAGG + Intergenic
1192164884 X:68821807-68821829 TATTCCTGGGAGAGACTGGCAGG + Intergenic
1195657738 X:107348419-107348441 CTTGCCTGGTAGAGCCTGGGTGG - Intergenic
1195728309 X:107939747-107939769 CCTTGCTGGGGTGGGCTGGGTGG - Intergenic
1196387183 X:115170298-115170320 CCTGTCTGTGAGAGGCTGTGAGG + Exonic
1197923174 X:131617824-131617846 CAATCCTGCAAGAGGCTGGGTGG + Intergenic
1200236358 X:154469608-154469630 CCCTCCTGGGTGTGGGTGGGTGG + Intronic
1200936703 Y:8744669-8744691 CATTCCTGGAAGAGACTGTGTGG + Intergenic
1201299684 Y:12494952-12494974 CCGTCCTGGGAGAGAATGAGAGG - Intergenic
1201742728 Y:17341526-17341548 AGTTGTTGGGAGAGGCTGGGTGG + Intergenic
1202063037 Y:20908300-20908322 ACTTCATGGGACTGGCTGGGTGG - Intergenic