ID: 1122721314

View in Genome Browser
Species Human (GRCh38)
Location 14:103724087-103724109
Sequence GTGGGGTGATGGAGGATCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122721305_1122721314 3 Left 1122721305 14:103724061-103724083 CCATGCCTATGAGGGAGAGGATC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1122721314 14:103724087-103724109 GTGGGGTGATGGAGGATCCGTGG 0: 1
1: 0
2: 2
3: 12
4: 208
1122721304_1122721314 4 Left 1122721304 14:103724060-103724082 CCCATGCCTATGAGGGAGAGGAT 0: 1
1: 0
2: 0
3: 13
4: 134
Right 1122721314 14:103724087-103724109 GTGGGGTGATGGAGGATCCGTGG 0: 1
1: 0
2: 2
3: 12
4: 208
1122721308_1122721314 -2 Left 1122721308 14:103724066-103724088 CCTATGAGGGAGAGGATCAGGGT 0: 1
1: 0
2: 2
3: 18
4: 199
Right 1122721314 14:103724087-103724109 GTGGGGTGATGGAGGATCCGTGG 0: 1
1: 0
2: 2
3: 12
4: 208
1122721303_1122721314 5 Left 1122721303 14:103724059-103724081 CCCCATGCCTATGAGGGAGAGGA 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1122721314 14:103724087-103724109 GTGGGGTGATGGAGGATCCGTGG 0: 1
1: 0
2: 2
3: 12
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122721314 Original CRISPR GTGGGGTGATGGAGGATCCG TGG Intronic
900145695 1:1157910-1157932 GAGGGGGGAGCGAGGATCCGGGG + Intergenic
900475405 1:2874069-2874091 CTGGGGTGATGCAGGATTGGGGG + Intergenic
900710978 1:4113742-4113764 GTGGGGTGATGGATGATGAGTGG - Intergenic
901217170 1:7561330-7561352 CTGGGGTGATGGAGGGACAGAGG + Intronic
902207949 1:14883559-14883581 GAGGGATGATGGAGGATGGGAGG - Intronic
902414235 1:16229736-16229758 CTGTGGTGATGGAGGTCCCGGGG + Intergenic
902822122 1:18949827-18949849 GTGGGGGGAAGGGGGACCCGGGG + Intronic
905130920 1:35756541-35756563 GAGAGGTGATGGAGGATGAGAGG - Intronic
905308743 1:37035360-37035382 GTGGGATGGAGTAGGATCCGTGG + Intergenic
905374860 1:37513659-37513681 GTGGAGAGATGGAAGATACGGGG + Intronic
910728027 1:90359341-90359363 GTGAGGTGGTGGATGATCAGAGG + Intergenic
914674752 1:149899951-149899973 GTGGGGTTAGGGCGGATGCGGGG + Exonic
915596450 1:156899158-156899180 ATGAGGAGATGGAGGATCAGAGG + Intronic
917609190 1:176669011-176669033 GTGGGTTGAGGGAGGATGGGAGG + Intronic
919976073 1:202613743-202613765 GTGGGGTGCTGCAGGGACCGTGG - Intronic
922720394 1:227897163-227897185 GAGGGGTGAGGGAGGACCCATGG - Intergenic
922758521 1:228109732-228109754 GGGGGCTGAGGGAGGATCCTCGG + Intergenic
922758564 1:228109860-228109882 CTGGGCTGAGGGAGGATCCAGGG + Intergenic
1064247341 10:13679581-13679603 GTGGGGTCAAGGAGGTTCTGTGG + Intronic
1067834864 10:49632317-49632339 GTGGGGTGATGGGGGAGCCAGGG + Intronic
1068548946 10:58385158-58385180 GGAGGGTGATGGAGGGACCGCGG - Exonic
1069872875 10:71543789-71543811 GTGGGGATGTGGAGGATCCCAGG + Intronic
1070259210 10:74838000-74838022 GAGGGGAGAAGGAGGATCCAAGG + Intronic
1071579304 10:86755892-86755914 GCAGGGTGATGGAGGCTCCCCGG - Intergenic
1072736281 10:97881763-97881785 GTGGGGAGGTGGAGGAGCAGTGG - Intronic
1075082179 10:119391515-119391537 GCGGGGTGGTGGAGGCTCAGGGG - Intronic
1075937069 10:126351568-126351590 GTGCAGTGCTGGGGGATCCGAGG - Intronic
1076091939 10:127693954-127693976 ATGGGGTGAGGGAGTAACCGAGG + Intergenic
1076553542 10:131304940-131304962 GTGGGCTGCTGGAGGAGACGTGG - Intronic
1077357660 11:2126194-2126216 GTGGGTGGATGGAGGGTGCGTGG + Intergenic
1077554130 11:3217877-3217899 GTGGGGTGAGCGAGGGTCGGTGG + Intergenic
1079284568 11:19117242-19117264 CTGGGGAGATGGAGGGGCCGGGG + Exonic
1079747362 11:24150324-24150346 GTGGGGTGATGGTTCATCCCAGG + Intergenic
1079996197 11:27297513-27297535 TTGGAGTCATGGAGGATCAGTGG - Intergenic
1080388893 11:31826275-31826297 GTGGGGTGAGGGAGGGACCCGGG + Intronic
1080458645 11:32435685-32435707 CTGGGGTGAGGGCGGGTCCGAGG + Intergenic
1081793507 11:45804863-45804885 GTCGGGGGACGGAGGCTCCGGGG + Exonic
1084403233 11:68956696-68956718 CTGGGGTGATGGAGGAGGCTAGG - Intergenic
1084672731 11:70616670-70616692 GTGGGGTGTGGGGGGATCTGAGG + Intronic
1085199840 11:74695222-74695244 GGGAGGGGATGGAGGAGCCGTGG + Intergenic
1087119675 11:94560361-94560383 GTGGGGTGAGGGAGGATCCCTGG - Intronic
1087377979 11:97368019-97368041 GTGGGGTGCTGGTGGGTACGGGG - Intergenic
1089178771 11:116566614-116566636 GTGGGGAGATGGGGGATTCATGG + Intergenic
1089563746 11:119359481-119359503 GTGGAGTGGAGGAGCATCCGGGG + Intronic
1089924137 11:122239663-122239685 GTGGGGATATGGAGGAGCAGAGG - Intergenic
1090977119 11:131687860-131687882 GTGTGGGGCTGGAGGATACGTGG - Intronic
1092680451 12:10974249-10974271 GTGGGGTGCAGGTGGATCCAAGG - Intronic
1094436943 12:30431024-30431046 GTGGGATGAAGGAAGATCAGTGG + Intergenic
1099603633 12:84773377-84773399 GTGGGGTGATGGGGCATACATGG + Intergenic
1100360025 12:93868871-93868893 GTGGGTTGTTGGGGGATCCCAGG + Intronic
1103719534 12:122966000-122966022 GGGAGGTGTTGGAGGATCCTGGG - Intronic
1104940437 12:132392315-132392337 GCGGGGTGGTGGAGGGTCCCCGG - Intergenic
1104940491 12:132392429-132392451 GCGGGGTGGTGGAGGGTCCCCGG - Intergenic
1104940518 12:132392486-132392508 GTGGGGTGGCGGAGGGTCCCCGG - Intergenic
1105373588 13:19822108-19822130 GTAGGCTGAGGGAGGATCCCTGG - Intergenic
1108675198 13:52730898-52730920 GTGGGGTCCTGGACGAACCGGGG + Intronic
1112184176 13:97112269-97112291 GTGAGGGGATGGAGGAGCCCAGG - Intergenic
1113850835 13:113417139-113417161 GTGGGGTGCTGGTGCATCCGGGG - Intergenic
1113904374 13:113812560-113812582 GTGCGGTGAGGGAGAAGCCGCGG - Exonic
1114535745 14:23421169-23421191 TGGGGGTGATGTAGGATCCCTGG + Intronic
1116812790 14:49555427-49555449 GGGGGATGATGGAGGATCAAAGG + Intergenic
1117156835 14:52950666-52950688 GGGAGGTGGTGGAGGACCCGGGG + Intronic
1117973388 14:61274282-61274304 GTGGGGTGTTGGAGGAAAAGTGG + Intronic
1118480659 14:66161993-66162015 GTTGGCTGATGGAGAATCCCTGG + Intergenic
1119386566 14:74261037-74261059 CAGGGGTGATGGAGGACCTGTGG - Exonic
1119896107 14:78221122-78221144 GTGGGGTGGTGGAAGTTCAGGGG + Intergenic
1122071431 14:99207938-99207960 GTGGGGAGATGGAGACTCAGGGG - Intronic
1122140348 14:99659785-99659807 GTGGGGTGGGGGCGGATTCGGGG - Intronic
1122657961 14:103274346-103274368 GTGGGGTGGCGGGGGACCCGCGG - Intergenic
1122721314 14:103724087-103724109 GTGGGGTGATGGAGGATCCGTGG + Intronic
1123091794 14:105745259-105745281 GTGGGGTGCAGGAGGAGCAGGGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124491716 15:30162071-30162093 GTGGGGTGCTGTAGGGACCGTGG - Intergenic
1124691150 15:31824282-31824304 GTGAAGTGATGGAGGGTCGGGGG - Intronic
1124751820 15:32376238-32376260 GTGGGGTGCTGTAGGGACCGTGG + Intergenic
1129393600 15:75232746-75232768 GTGGGAGGCTGGAGGATCAGTGG + Intergenic
1132644690 16:993546-993568 GTGGGTGGATGGAGGATGGGAGG - Intergenic
1135473218 16:22750960-22750982 GTAGGGTGGTGGGGGATCTGAGG + Intergenic
1136157959 16:28397838-28397860 GTAGGGGGATGGAGGATGGGTGG - Intronic
1136205128 16:28717445-28717467 GTAGGGGGATGGAGGATGGGTGG + Intronic
1141427992 16:83956015-83956037 GTGAGGAGAAGGAGGCTCCGAGG - Intronic
1141495697 16:84408050-84408072 GTGTGGTGAGAGAGGATCCTTGG + Intronic
1141670935 16:85491390-85491412 GTGGGGTGTTGGAAGATGCAGGG + Intergenic
1141683301 16:85556410-85556432 GTCGGGTGAGGGAGGGTCCCGGG - Intergenic
1142253303 16:89002504-89002526 CTGGGGGGACGGAGGAGCCGGGG + Intergenic
1144767644 17:17741384-17741406 ATGGGGTGATGGAGGGGCCCGGG - Intronic
1145282538 17:21478335-21478357 GGGGGGTGATGGACTATCCCTGG + Intergenic
1147574866 17:41593301-41593323 GTGGGGTAAAGGAGGAGCCCAGG + Intergenic
1148797142 17:50202442-50202464 GTTGGGTGATGGAGCAGCCAAGG + Intergenic
1150216831 17:63476000-63476022 GTGGGGCAATGGAGGAACCGTGG - Intergenic
1151460809 17:74253027-74253049 GAAGGGTGAAGGAGGCTCCGAGG - Intronic
1151462166 17:74260814-74260836 GTGGGGGGCTGGTGGCTCCGGGG + Exonic
1152063671 17:78097980-78098002 GTGGCGTGATGAAGGATGGGTGG + Intronic
1152812408 17:82388287-82388309 CTGGGGAGCTGGAGGACCCGCGG - Intergenic
1155894666 18:31310292-31310314 ATAGGGTGATGGAGGCTCAGGGG - Intergenic
1157533940 18:48444761-48444783 GTGGGGTGCTGGAGGGTCACTGG + Intergenic
1157619457 18:49007928-49007950 GACGGGTGATGCAGGATCCCAGG + Intergenic
1160942469 19:1626891-1626913 CTGGGGTGAGGGAGGAACCCTGG + Intronic
1161477884 19:4496440-4496462 GTGGGGTGATGCGGGGTGCGGGG - Intronic
1161739590 19:6012572-6012594 GGGGGGTGATGCTGGCTCCGCGG + Intronic
1161953401 19:7479818-7479840 TTGGGGTGATGATGGATCCATGG + Intronic
1161978765 19:7619928-7619950 GTGAGGTGAGGGCGGATCCTTGG - Exonic
1163672550 19:18637280-18637302 GTGGGGTACTGGAGGAGCCGAGG + Intronic
1165363500 19:35350772-35350794 GCGGGCTGATGGAGGATGCCCGG - Intergenic
1165384145 19:35500647-35500669 GTGGGGTGAGGGAGAAACTGGGG - Intronic
1165785532 19:38459527-38459549 GTGGGGTTAGGGAGAATCTGAGG - Intronic
1168075378 19:53978442-53978464 GCGGGCTGAGGGAGGATCCTGGG + Intronic
1168258263 19:55179000-55179022 GTCGGGCGATGGAGGCCCCGGGG + Exonic
925152058 2:1621669-1621691 CTCGGGTGATGCAGGATCCCAGG + Intergenic
925975782 2:9141045-9141067 TTGGGGTGATGGAGTATTGGAGG + Intergenic
927281825 2:21315436-21315458 GTGGGGGGATGGAGGAACACAGG + Intergenic
927809192 2:26172717-26172739 GGCGGGTGATGGAGGACCCCAGG - Intergenic
929732454 2:44510494-44510516 GTGTTGTAATGGAGGATCCTAGG - Intronic
936291900 2:111232284-111232306 GTGGGGTCATGGGGGAGCAGTGG + Intergenic
936671487 2:114662168-114662190 GGTGCGTGATGGAGGCTCCGAGG + Intronic
937219277 2:120332511-120332533 CTGGGCTTATGGAGGAACCGTGG - Intergenic
945357627 2:208857853-208857875 TTGGGGTGCTGGAGAATCCAAGG + Intergenic
948063380 2:235058615-235058637 GTGGGGTGATGGATACTCAGAGG - Intergenic
948537598 2:238657842-238657864 GTGGGCTGATGGAGGCTCAAGGG - Intergenic
948540157 2:238685520-238685542 GTGGGGTGATGGAGAGTCCGGGG - Intergenic
1169198927 20:3698164-3698186 GTGGGGCCCTGGAGCATCCGTGG - Intronic
1172049948 20:32109809-32109831 ATGGGGTGCTGGAAGATCCTGGG - Intronic
1174445820 20:50590454-50590476 GTGGGGCGATGGAGGGGCCCAGG + Intronic
1175707678 20:61193117-61193139 GTGGGGTGGTGGGGGATGCGGGG - Intergenic
1175905757 20:62378572-62378594 CTGGAGTCATGGAGGATTCGAGG - Intergenic
1176409261 21:6438991-6439013 GTGGGGTCACGCAGGATTCGTGG + Intergenic
1179250084 21:39664885-39664907 GTGTCGTGCTGGAGGATCCTGGG + Exonic
1179684756 21:43047313-43047335 GTGGGGTCACGCAGGATTCGTGG + Intergenic
1179818384 21:43922474-43922496 GTGGGGTTAAGGAGGGTCCCAGG - Intronic
1180782448 22:18528760-18528782 GTGGGGTGAGGTAGGACCGGCGG + Intronic
1181126001 22:20702787-20702809 GTGGGGTGAGGTAGGACCGGCGG + Intergenic
1181239338 22:21468095-21468117 GTGGGGTGAGGTAGGACCGGCGG + Intergenic
1181328904 22:22074144-22074166 GTGGGGTGATAGCTGATCCCAGG - Intergenic
1182043464 22:27256471-27256493 GTGGAGAGATGGAGGCTCAGAGG - Intergenic
1182868746 22:33627655-33627677 GTGGGGTGATGAAGGAGGCCTGG - Intronic
1183748984 22:39708621-39708643 GTAGGGTGAGGGGGGACCCGTGG - Intergenic
1184422918 22:44392207-44392229 ATGGGTTGAAGGAGGCTCCGTGG + Intergenic
1185020260 22:48370422-48370444 GTGCGGAGGTGGAGGCTCCGTGG - Intergenic
1185159901 22:49217401-49217423 CTGGGGTGATGGTGGATTAGCGG - Intergenic
953628124 3:44587656-44587678 GGGTGGTGATGGAGGAGCTGAGG - Intronic
954798155 3:53172000-53172022 GTGGGGTGAGGGAGGGGCCCAGG + Intronic
956510243 3:69985460-69985482 GAGGGGTGATGGGGGAGGCGGGG + Intergenic
961420354 3:126798123-126798145 GTGGTGTGCTGGAGGTTCTGCGG + Intronic
962083971 3:132171357-132171379 CTGGGGTGAGGGAGGATTGGAGG - Intronic
962293258 3:134155138-134155160 GTGGGGTGAAGAAGGAAGCGGGG - Intronic
962321279 3:134392663-134392685 GTGTGGAGAAGGAGGATCAGTGG + Intergenic
962941056 3:140125131-140125153 GTGGGTTGAGGGAGGATAGGGGG + Intronic
965494424 3:169380795-169380817 GTGGGGAGTTGGAGGATTGGAGG - Intronic
968713732 4:2139187-2139209 GTGGGGAGAGGGAGGAGCCACGG + Intronic
968807468 4:2784736-2784758 GTGGGGAGATGGCGGATAGGAGG - Intergenic
968917437 4:3502693-3502715 GTTGTGTGGTGGAGGAGCCGTGG + Intergenic
968966634 4:3772286-3772308 GTGGGGACATGGAGGGGCCGTGG - Intergenic
980170159 4:129279864-129279886 ACGAGGTGATGGAGGTTCCGAGG - Intergenic
983637662 4:169914566-169914588 GTGGGGTGATGGGAGATGGGAGG + Intergenic
985572431 5:655608-655630 GTGGGGTGGTGGAGGGCGCGGGG + Intronic
985849559 5:2378808-2378830 GAGGGGTGATGGAGGCTGCTTGG - Intergenic
987201385 5:15581348-15581370 GTGGGGAGATGGAGGATGGGCGG - Intronic
988954501 5:36301235-36301257 GTGGGCTGGTGAAGGACCCGGGG - Intronic
994774224 5:104024304-104024326 TTGGGGTGATGGAGGAGTCCTGG + Intergenic
995609873 5:113898049-113898071 GCAGGCTGATGGAGGATCAGAGG + Intergenic
995794343 5:115925771-115925793 GTGAGGTTATGTAGGATCCTAGG - Intergenic
996177105 5:120372202-120372224 GTGGAATGATAGAGGATCCCTGG - Intergenic
997625190 5:135326693-135326715 CTGCGGGGATGGAGGCTCCGAGG + Intronic
997878088 5:137566852-137566874 GTGAGGTGGGGCAGGATCCGAGG + Intronic
998394946 5:141812270-141812292 GTGGGGTTTTGGAGGAGCCCGGG + Intergenic
999150424 5:149422830-149422852 ATGGGGTGAGGGAGGTTCCAGGG + Intergenic
1000410825 5:160934003-160934025 GTGGGGTCTTGGAGGGTCCATGG + Intergenic
1001374223 5:171239539-171239561 GTGGGGAGTTGGAGGTTCAGGGG + Intronic
1002780463 6:361250-361272 GTGGGGTGAGTGAGGACTCGGGG - Intergenic
1006669705 6:35722398-35722420 GTGGGCTAATGGGGGATCGGAGG + Intronic
1006923955 6:37644053-37644075 GTGGGGTGAGGCAGGATGCGTGG - Intronic
1006923960 6:37644072-37644094 GTGGGGTGAGGCAGGATGCGTGG - Intronic
1006923965 6:37644091-37644113 GTGGGGTGAGGCAGGATGTGTGG - Intronic
1006923982 6:37644150-37644172 GTGGGGTGAGGCAGGATGCGTGG - Intronic
1007781543 6:44257423-44257445 GTGGGGTGGAGGGGGAACCGGGG + Exonic
1007973050 6:46072282-46072304 GTGGGGGGAGGGGGGATCCTAGG + Intronic
1010482062 6:76367481-76367503 GTTGGGTGGTGGAGGATGAGGGG - Intergenic
1011655639 6:89549378-89549400 GTGGGGTGGTGGGGGATTGGGGG - Intronic
1013473325 6:110485573-110485595 GTGGGGTGAGGGAGGAAGCAAGG - Intergenic
1013985946 6:116193986-116194008 GTGGGGTGATCATGGATCCTGGG - Intronic
1014156440 6:118115382-118115404 GTGAGGTGATGGAGGAATCAAGG + Intronic
1018091657 6:160350830-160350852 GTGGAATGATGGAGGGTCAGGGG + Intronic
1018812605 6:167308558-167308580 GTGGGGTGCAGGAGGAACCAGGG + Intronic
1018871926 6:167790256-167790278 GTGGGGAGATGGATGATGAGGGG - Intronic
1019149432 6:169994248-169994270 GTGGGGTGATCCAGGAGCAGGGG + Intergenic
1019167928 6:170111192-170111214 GTGGGGTGGTGGAGGAAGCAGGG - Intergenic
1021707707 7:23384282-23384304 GTGGGGTGATAGGGGTTCAGTGG + Intronic
1022757573 7:33310113-33310135 GTGGGGTGATTGAGGAGGCAAGG - Intronic
1023571526 7:41577187-41577209 GGTGGGGGAAGGAGGATCCGAGG + Intergenic
1023983129 7:45081079-45081101 GTGGTGGAATGGGGGATCCGAGG - Intronic
1026012262 7:66645831-66645853 GTGGTGTGGTGGAGGGTCAGGGG - Intronic
1026105351 7:67416647-67416669 GTGGGCTCATGGAGGGTCCTTGG + Intergenic
1028638321 7:93015974-93015996 GTTGGTTGATGGAGGATGGGGGG - Intergenic
1029380642 7:100212240-100212262 GTAGGGAGATGGAGGATAGGGGG - Intronic
1030537683 7:110789689-110789711 GTGAGGTGGTGGAGGCTCAGAGG - Intronic
1034465640 7:151227000-151227022 GCGGGGTGGGGGAGGACCCGGGG - Intronic
1034947605 7:155273421-155273443 ATGGAGAGATGGAGGCTCCGGGG + Intergenic
1035560357 8:599638-599660 GTGGGGTGAGGAATGAGCCGTGG - Intergenic
1036620797 8:10423579-10423601 GTGGGGTGGTGCAGGAGCAGGGG - Intronic
1037674940 8:21043792-21043814 GTGGGGTGGTGGAAGGTCGGGGG - Intergenic
1044723121 8:95169519-95169541 GTGGGGTGAGGGAGAATAAGTGG + Intergenic
1050508273 9:6369456-6369478 CTGGGGTGATGAAGGATGCAAGG + Intergenic
1051260699 9:15261546-15261568 GTTGGGTCATGGAGGATTCCTGG - Intronic
1053576044 9:39357981-39358003 GTGGGGTGGTGGAGGGGCTGTGG + Intronic
1054097615 9:60916672-60916694 GTGGGGTGGTGGAGGGGCTGTGG + Intergenic
1054119017 9:61192302-61192324 GTGGGGTGGTGGAGGGGCTGTGG + Intronic
1054588735 9:66990260-66990282 GTGGGGTGGTGGAGGGGCTGTGG - Intergenic
1055986749 9:82061425-82061447 GTGGGGTGGTGGAGGGGCTGTGG - Intergenic
1056580269 9:87884813-87884835 TTGGGGAGGTGGAGGAACCGGGG + Intronic
1057160426 9:92884789-92884811 GTGGGGTGGTGGAGGGGCTGTGG + Intergenic
1057261481 9:93587218-93587240 GAGGGATGATGGAGGAGCCCTGG + Intronic
1057261543 9:93587434-93587456 GAGGGATGACGGAGGATCCCTGG + Intronic
1057261559 9:93587481-93587503 GAGGGATGATGGAGGAGCCCCGG + Intronic
1057704298 9:97386671-97386693 GGGGGGTGCTGGAGGAGCCCTGG + Intergenic
1059402804 9:114081200-114081222 GTGGGAGGATGGAGGCTCTGGGG + Intergenic
1059566238 9:115385573-115385595 GTGGGGTGGTGGGAGATCCTGGG + Intronic
1060113835 9:120925913-120925935 GTGAGGTGATGGAGGAGCGGAGG - Intronic
1060153785 9:121304939-121304961 GTGGGGTGATGTGGGATCCCAGG + Intronic
1061291661 9:129653831-129653853 GTGGGAGGGTGGAGGACCCGAGG + Intergenic
1061824118 9:133247246-133247268 GTGGGGAGACTGAGGATCAGAGG + Intergenic
1190324024 X:49195615-49195637 GTGGTGTGATGGAGGAGAGGTGG + Intronic
1198214767 X:134545847-134545869 GGGGGGTTAGGGAGGCTCCGTGG - Intergenic
1200211429 X:154348399-154348421 GTGGGGTGAAGCAGGAGCCCTGG + Intergenic