ID: 1122722300

View in Genome Browser
Species Human (GRCh38)
Location 14:103728989-103729011
Sequence AGCCGGATCCTGCTTGGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122722295_1122722300 -5 Left 1122722295 14:103728971-103728993 CCAATAACCAGAGGTAAGAGCCG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1122722300 14:103728989-103729011 AGCCGGATCCTGCTTGGCACGGG 0: 1
1: 0
2: 1
3: 5
4: 75
1122722293_1122722300 20 Left 1122722293 14:103728946-103728968 CCTGAAACTATGACTTGTCGTCT 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1122722300 14:103728989-103729011 AGCCGGATCCTGCTTGGCACGGG 0: 1
1: 0
2: 1
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122722300 Original CRISPR AGCCGGATCCTGCTTGGCAC GGG Intronic
900077077 1:826880-826902 AGCGGGCTCCTCCTTGGCAGGGG - Intergenic
902624524 1:17668844-17668866 AGCCGGCTCCACCTTGGCGCTGG + Intronic
903537323 1:24075606-24075628 AGCCGGATCCTGCAAGGCCTTGG - Intronic
904364970 1:30004695-30004717 CTCTGGATCCTGCCTGGCACTGG + Intergenic
906293664 1:44635994-44636016 AGCAGGATCATGCTGGGCCCAGG - Intronic
906833269 1:49057334-49057356 AGCCTGAACCTCCTTGGCTCAGG - Intronic
909475149 1:76073954-76073976 AGCCGGCTCTTGCTTGGAGCAGG + Intergenic
916268732 1:162918213-162918235 AGCCGGACCCGGCTTGGTTCAGG - Intergenic
918177410 1:182058047-182058069 AGGAGTATCCTGCTTGGCTCAGG + Exonic
922125839 1:222722415-222722437 AACAGCATCCTGCTGGGCACTGG - Exonic
924625285 1:245692387-245692409 AGCAGGATCCTGCAAGGCAAAGG + Intronic
1066109109 10:32180790-32180812 AGCCGGACCTTGCTTGGTTCTGG + Intergenic
1070507008 10:77122761-77122783 AGCCAGATGCTTCTTGGCATTGG - Intronic
1070660914 10:78304631-78304653 AGCTGGCTCCTGCCTGGCTCTGG + Intergenic
1073103066 10:101016937-101016959 AGCTGGACCCTGCTTTGCCCTGG - Intronic
1076841642 10:133048863-133048885 AGCCGGATGCTCCTGGGCGCAGG + Intergenic
1087370669 11:97279798-97279820 AGCAGGATCCTTTTTGGCATAGG - Intergenic
1094597312 12:31876908-31876930 AGCCGGACCCGGCTTGGTTCCGG - Intergenic
1097279725 12:57837351-57837373 GGCCGGACCCAGCTTAGCACCGG + Intronic
1103453628 12:121047735-121047757 AGCCGGACCCGGCTTGGTTCTGG - Intergenic
1120959939 14:90115315-90115337 AGCCCGCTCCTGCTGGTCACTGG + Intronic
1122722300 14:103728989-103729011 AGCCGGATCCTGCTTGGCACGGG + Intronic
1122899784 14:104777691-104777713 AGCCTCCTCCTGCTTTGCACAGG - Intronic
1124693574 15:31845522-31845544 AGCCGGATCCTCTGTGGCCCTGG - Intronic
1127947556 15:63770462-63770484 TGCCAGATACTGCTAGGCACTGG - Intronic
1132344714 15:101101249-101101271 AGCGGGATCCTGCTTCCCCCGGG - Intergenic
1132574460 16:658114-658136 AGCCTGACCCTGGGTGGCACCGG + Intronic
1136625551 16:31459773-31459795 AGCCGGGGCCTGCCTGGGACGGG - Exonic
1139470223 16:67174426-67174448 CGCCGGACCCCGCTTGGGACTGG + Exonic
1151375254 17:73684098-73684120 TGCCGGATACTGCTGGGCATAGG + Intergenic
1154082520 18:11272496-11272518 AGCAGGAGCCTGCTAAGCACAGG + Intergenic
1161062369 19:2221727-2221749 AGCCGGGACCTGCAGGGCACAGG + Intronic
1161808217 19:6457399-6457421 AGCTGTATCCTCCTTGGGACTGG + Intronic
1161857771 19:6775560-6775582 AGCCTGATACAGCTGGGCACAGG - Intronic
1162790354 19:13059553-13059575 AGCTGGAGGCTGCTTGCCACTGG + Intronic
1167359125 19:49020531-49020553 AGCCAGCTCCTGCTTGGCTACGG - Intergenic
927791406 2:26012724-26012746 GGCAGGATCCTGTTTGGCAAGGG - Intergenic
929874678 2:45786715-45786737 ACTCAGAGCCTGCTTGGCACAGG - Intronic
930658411 2:54029873-54029895 AGCCGGACCCGGCTTGGTTCTGG - Intronic
931345138 2:61439509-61439531 AGCTGGATGGTGCTGGGCACTGG - Intronic
932340482 2:70960159-70960181 AGCCCCTGCCTGCTTGGCACAGG - Intronic
946757184 2:222959560-222959582 AGCCGGATCCTGGATCCCACTGG - Intergenic
1171191500 20:23162640-23162662 AGATGGACCCTGGTTGGCACTGG + Intergenic
1175423963 20:58852834-58852856 AGCCGGAGCCAGCTCGGCACTGG + Exonic
1184070324 22:42142983-42143005 AGCCCGGTCCAGCTGGGCACAGG + Intergenic
1184542063 22:45132679-45132701 TTCCGGATCCTGCGTGGCCCTGG + Intergenic
1184931124 22:47682117-47682139 AGCCGCATGCTGTCTGGCACTGG + Intergenic
1185004069 22:48265113-48265135 AGCCGGACCCTGCTGTGAACCGG - Intergenic
959323048 3:104903925-104903947 AGCCGGATGCTGGTTTCCACTGG + Intergenic
961416854 3:126765546-126765568 ACCTGGATCCTGCGTCGCACAGG - Intronic
961481443 3:127183382-127183404 GTGGGGATCCTGCTTGGCACAGG + Intergenic
964086992 3:152830914-152830936 AGCTGGGCCCTCCTTGGCACAGG + Intergenic
967920159 3:194608552-194608574 AGACGGGTCCTGCTTCGGACTGG + Intronic
970245616 4:14059229-14059251 AGCATGATCCTGCATAGCACTGG - Intergenic
971282833 4:25255798-25255820 AGCCTCATCCTGCTGGGCTCAGG + Intronic
971282838 4:25255824-25255846 AGCCTCATCCTGCTGGGCTCAGG + Intronic
978761389 4:112358557-112358579 AGCCAGACCCTGCCTGGCAGAGG + Intronic
983450792 4:167908637-167908659 ACCCAGAACCTGGTTGGCACTGG - Intergenic
988657372 5:33227095-33227117 AGCCAGATCCAGCTTGGTTCTGG + Intergenic
993396439 5:87395581-87395603 AGCTGGGACCTGCTGGGCACAGG + Intronic
993442104 5:87969927-87969949 AACCGAATTCTGCTGGGCACTGG - Intergenic
1002132125 5:177087946-177087968 AGCTGGATCCTGCTGGGCACAGG + Intronic
1003066814 6:2910845-2910867 AGCCAGATCATTCTTTGCACTGG + Intergenic
1007783123 6:44265371-44265393 AGCCGGATCCTGCTCAGACCGGG - Exonic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1011208692 6:84930515-84930537 ATCTGGATCCTGCTTGGAACTGG - Intergenic
1014394070 6:120902537-120902559 AGCCCCAACCTCCTTGGCACAGG + Intergenic
1016995564 6:149960502-149960524 AGCTGGAGCCAGCTTGGCATGGG - Intergenic
1019113786 6:169740214-169740236 AGCAGAATCCTACGTGGCACTGG - Exonic
1019145272 6:169971862-169971884 GCCCGGGTCCTGCTTGTCACTGG + Intergenic
1026893739 7:73998293-73998315 GGCCGGCTCCTGCCTGGCTCTGG - Intergenic
1031470751 7:122166373-122166395 AGCTGGCCCCTGCCTGGCACTGG + Intergenic
1033607687 7:142939561-142939583 GCACGGATCCTGCTGGGCACTGG + Exonic
1035626077 8:1071499-1071521 ATCTGGATCCTGTCTGGCACCGG - Intergenic
1044599215 8:93986996-93987018 ATCCAGTTCCTGCTTGTCACAGG + Intergenic
1045243130 8:100419715-100419737 AAATGGATCCTGCATGGCACTGG - Intergenic
1049805219 8:144535716-144535738 AGCCTGAGCCTGCTTGGGACTGG + Intronic
1059731162 9:117058679-117058701 AGCCAGATACTGCTAGGCACAGG + Intronic
1060583345 9:124770976-124770998 AGCCGGTTCCTGCCTGGCCCGGG + Intronic
1187633976 X:21206100-21206122 TGCAGGCTCCTGTTTGGCACTGG - Intergenic
1193420879 X:81280513-81280535 ACCCAGATCCTGGTTGGTACTGG - Intronic
1195243925 X:102979350-102979372 AGGGGGATCCTGTCTGGCACAGG - Intergenic