ID: 1122722993

View in Genome Browser
Species Human (GRCh38)
Location 14:103732470-103732492
Sequence CTGGTGCTCAGGAGCACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 239}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122722993_1122723003 18 Left 1122722993 14:103732470-103732492 CCCTGGGTGCTCCTGAGCACCAG 0: 1
1: 0
2: 3
3: 28
4: 239
Right 1122723003 14:103732511-103732533 TCTTGGAGCAGCACAAGGTTAGG 0: 1
1: 0
2: 0
3: 10
4: 154
1122722993_1122723000 1 Left 1122722993 14:103732470-103732492 CCCTGGGTGCTCCTGAGCACCAG 0: 1
1: 0
2: 3
3: 28
4: 239
Right 1122723000 14:103732494-103732516 CCTCACTGCCAGGCTACTCTTGG 0: 1
1: 0
2: 0
3: 15
4: 227
1122722993_1122723002 13 Left 1122722993 14:103732470-103732492 CCCTGGGTGCTCCTGAGCACCAG 0: 1
1: 0
2: 3
3: 28
4: 239
Right 1122723002 14:103732506-103732528 GCTACTCTTGGAGCAGCACAAGG 0: 1
1: 0
2: 0
3: 10
4: 133
1122722993_1122722996 -9 Left 1122722993 14:103732470-103732492 CCCTGGGTGCTCCTGAGCACCAG 0: 1
1: 0
2: 3
3: 28
4: 239
Right 1122722996 14:103732484-103732506 GAGCACCAGCCCTCACTGCCAGG 0: 1
1: 0
2: 2
3: 26
4: 234
1122722993_1122723004 27 Left 1122722993 14:103732470-103732492 CCCTGGGTGCTCCTGAGCACCAG 0: 1
1: 0
2: 3
3: 28
4: 239
Right 1122723004 14:103732520-103732542 AGCACAAGGTTAGGATGTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122722993 Original CRISPR CTGGTGCTCAGGAGCACCCA GGG (reversed) Intronic
900682606 1:3925106-3925128 CAGGTGCTGAGGGCCACCCAGGG - Intergenic
904055696 1:27668603-27668625 CTGATGCTCAGGACCACTCCTGG + Intronic
904081863 1:27877282-27877304 TTGGTGCTCAGGAAACCCCAAGG + Intronic
906819084 1:48910678-48910700 CCAGTGGTCAGGGGCACCCACGG - Intronic
910488126 1:87738305-87738327 GTGGTGTTCCGGAGCAACCATGG + Intergenic
911685242 1:100768285-100768307 CTAGTGTTCAGTAGCACCAAAGG + Intergenic
919802672 1:201363014-201363036 GCAGTGCTCAGGAGCCCCCAAGG - Intronic
919885377 1:201930067-201930089 CTGGCGCTCTGGAGAACCAATGG + Intronic
920199257 1:204249407-204249429 CTTGTTCTCAGGAGCCACCAAGG - Intronic
921075660 1:211698567-211698589 GTGGTTCTGAGGGGCACCCAGGG + Intergenic
922887493 1:229031315-229031337 CTGTTGCTAAGGAACCCCCAGGG - Intergenic
923302533 1:232655253-232655275 TGTGTGCTCAGGAGCAACCATGG + Intergenic
923716011 1:236425325-236425347 CTGGGGGTCAGGAGAACACATGG + Intronic
924816142 1:247443655-247443677 GTGGTGCTGAGGAGCACTCCTGG + Intronic
1063093165 10:2885970-2885992 CTGGGACTCAGGGGCACCCTAGG + Intergenic
1063123383 10:3120289-3120311 CGGGTGCTCACGGGCACCCCTGG - Intronic
1063441531 10:6077226-6077248 CAGGTGCTCTGCAGCTCCCATGG - Intergenic
1064465614 10:15577444-15577466 CTGCAGCTTAGGAGCCCCCATGG - Intronic
1064568024 10:16663243-16663265 CTGGTGTACAGGAGCACGTAGGG - Intronic
1066126820 10:32349806-32349828 CAGGAGCTCAGGAGCAGCCTGGG - Intronic
1066540120 10:36437404-36437426 GTGGTGCTGAGAAGCAGCCATGG - Intergenic
1067342484 10:45417126-45417148 CTGGCACTCAGGGGCACTCAGGG - Intronic
1069420451 10:68241841-68241863 CGGGTGCTCAGGTCCACCCCTGG - Intergenic
1069761048 10:70811680-70811702 CTGGAGCCCAGGAGCAGCCTAGG + Intergenic
1069943371 10:71970185-71970207 CTGGTGGTCAGGGGCTCCCGGGG - Intronic
1070820238 10:79350086-79350108 CCAGTGCTCAGGGGCACACAGGG - Intronic
1075345958 10:121682055-121682077 CTGGTGCGGGGGAGCACCCCCGG - Intergenic
1075702362 10:124477867-124477889 CAGGTGCTCAGGAGGACATAGGG - Intronic
1075986318 10:126788578-126788600 CTGGTGCACGGTAGCAGCCATGG - Intergenic
1076491767 10:130866638-130866660 CTGGTGTGAAGGGGCACCCAGGG - Intergenic
1076804760 10:132849819-132849841 CCGGTGCTCAGGCCCACCCTAGG + Intronic
1077218376 11:1404554-1404576 CTGGTGCTCTGTGGCATCCAGGG - Intronic
1078340414 11:10494742-10494764 CTGGTGCTCAGGAGTTTCTAAGG + Intronic
1083633582 11:64108446-64108468 CTGGTGCTCAGGGAGACCCAGGG - Intronic
1084626368 11:70310920-70310942 CTGGTTCTTAGGAGCGCTCAAGG + Intronic
1085705807 11:78786202-78786224 CTGGTGCCGAGGAGACCCCAAGG + Intronic
1087146885 11:94821649-94821671 CGGGGGCTGTGGAGCACCCAGGG - Exonic
1088785927 11:113181761-113181783 CTGGACCTCAGAAGCAACCAGGG + Intronic
1088988899 11:114934118-114934140 CTGGTACACATGAGCAGCCATGG + Intergenic
1089173907 11:116534905-116534927 CTGGTGGCCAGGACCTCCCAGGG + Intergenic
1089305542 11:117524136-117524158 CTGCTGCTGAGGAGCCCCCAAGG - Intronic
1089692905 11:120197843-120197865 CTGTTGCTCAGGATCCACCAGGG - Intergenic
1089981648 11:122777405-122777427 CTGAGGCCCAGGAGCACCCCAGG + Intronic
1091039163 11:132260893-132260915 GTGGTGCTCAGGAGAAAACAAGG - Intronic
1091301030 11:134508406-134508428 CTGGTTCTCAGCAACACTCAAGG - Intergenic
1092261778 12:6956752-6956774 CTGGAGCTCAGAAGAGCCCAGGG - Intronic
1095952197 12:47787723-47787745 CAGGTACTCAGGATCCCCCATGG + Exonic
1101396805 12:104355921-104355943 CAGGTTCTCAGGAGCACTCTGGG + Intergenic
1101862038 12:108490559-108490581 CTATTGGTCAGGACCACCCAAGG + Intergenic
1102180793 12:110911093-110911115 CTGGTGCACATCATCACCCACGG - Exonic
1102479100 12:113208635-113208657 CTGGGGCCCAGGGTCACCCAGGG + Intronic
1102920357 12:116787233-116787255 CTGGTCCTCAGAAGTAGCCACGG - Intronic
1103696627 12:122820935-122820957 CAGTTCCTCAGGGGCACCCAAGG - Intronic
1104340406 12:127943718-127943740 TTGGTGCTCAGGAGCCCACATGG + Intergenic
1105892184 13:24689720-24689742 CTGGGGCTCAGGAGCAAAAATGG - Intronic
1106370672 13:29129754-29129776 CTGGTTCTCAGGGGCAGCCTTGG + Intronic
1112392815 13:99000908-99000930 GTGGAGCTCAGGAGCACCTAGGG + Intronic
1113090856 13:106616541-106616563 CAGGTTCTCAGGAGCACCCATGG - Intergenic
1113635474 13:111916315-111916337 GTGGTGCCCAGGGGTACCCAGGG - Intergenic
1113889467 13:113728336-113728358 ATGGTGATGAGGAGTACCCATGG + Intronic
1113889483 13:113728409-113728431 ATGGTGATGAGGAGTACCCATGG + Intronic
1113889495 13:113728463-113728485 ATGGTGATGAGGAGTACCCATGG + Intronic
1113913036 13:113853305-113853327 CTGGTGGTGAGGGGCAGCCAGGG + Intronic
1114674506 14:24431376-24431398 CTGGAGCTCAGGAGCGAGCAAGG + Intronic
1115433556 14:33348283-33348305 CTGGTGCTGAGGGGTCCCCATGG - Intronic
1117787986 14:59307357-59307379 CTGGTTCAAAGGAGAACCCAAGG - Intronic
1117999789 14:61512166-61512188 CTGGGGATCAGAAGCACTCAGGG + Intronic
1119658178 14:76432233-76432255 TGGATGCTCAGGAGCACCCCCGG - Intronic
1121650935 14:95557742-95557764 CTGGAGCTCGGGAGCAGCCTGGG - Intergenic
1121767748 14:96502334-96502356 CTGGTGCGCAGGCGCACGCACGG + Intronic
1122399274 14:101457803-101457825 GGGGTGCTCAGGAGGGCCCAGGG + Intergenic
1122722993 14:103732470-103732492 CTGGTGCTCAGGAGCACCCAGGG - Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1122880049 14:104686704-104686726 CTGCTGCTCAGGTGGACCCCAGG + Intergenic
1123175830 14:106417823-106417845 CAGGTGCTCAGAACCACCAAGGG - Intergenic
1124106251 15:26740562-26740584 CTCCTCCTCTGGAGCACCCAAGG + Intronic
1124395094 15:29294078-29294100 CTGGTGCTCAGAAGCAAAGAGGG + Intronic
1124630961 15:31336865-31336887 ATGATGCCCAGGTGCACCCAAGG - Intronic
1125055205 15:35351862-35351884 CTGGTGCTCACCAGCACACTTGG + Intronic
1125578526 15:40770451-40770473 CAGGTGTTCAGGAGCAGCCAGGG - Exonic
1128944979 15:71813835-71813857 CTGGGGCTCAGGGTCTCCCAGGG - Intronic
1129108933 15:73326332-73326354 CTGCTGCACAGAAACACCCACGG + Intronic
1132114352 15:99124859-99124881 CTGGTGCTCAGTGTCAGCCAGGG + Intronic
1132403887 15:101530686-101530708 CTGGCACACAGCAGCACCCAGGG - Intergenic
1132546881 16:537318-537340 GTGGTGCCCAGCTGCACCCAGGG - Intronic
1132877504 16:2146924-2146946 CTGCTGCTCAGGTACCCCCAGGG - Intronic
1132994975 16:2818089-2818111 CTGGGGCTCAGGAGAACACCAGG - Intronic
1134448374 16:14347823-14347845 CCTGTGCTCAGGAGGGCCCAGGG - Intergenic
1137711212 16:50568171-50568193 CGGGTGCTCAGGGGCCCCCCAGG - Intronic
1138417583 16:56880053-56880075 CTGGAGCTCAGGTGGCCCCAGGG + Intronic
1138733665 16:59225313-59225335 CCAGTGTTCAGGAGCATCCAGGG - Intergenic
1140440677 16:74985132-74985154 CTTGAGCTCAGGAGCAACCAGGG - Exonic
1141034799 16:80617882-80617904 GTGGTTCTCAGGTGCAGCCAGGG - Intronic
1141421374 16:83919770-83919792 ATGGTGCACAGGAGAACACACGG + Exonic
1141629550 16:85279701-85279723 CAGGTGCTCAGGAGGCCCCATGG - Intergenic
1142261743 16:89045753-89045775 CTGGATCTCTGGAGCACCCATGG + Intergenic
1142474757 17:182154-182176 CAGGTGATCAAGGGCACCCAGGG + Intergenic
1142489632 17:269957-269979 CTGGTGCTCACCAGCCCCCAGGG - Intronic
1146716256 17:35089219-35089241 CTGGGGCTGAGGGGCACCCGGGG + Exonic
1147836716 17:43338076-43338098 CTGTTGCTTATGAGCAGCCATGG + Intergenic
1148626587 17:49074017-49074039 CAGCTACTCAGGAGCACCAATGG - Intergenic
1148646058 17:49220158-49220180 CTGGTGTTCAGCAGCGCCGAAGG + Exonic
1148811038 17:50291526-50291548 CAGGAGTTCAGGAGCACCCTGGG - Intergenic
1149849157 17:60025254-60025276 CAGGTGATCAAGGGCACCCAGGG - Intergenic
1149861011 17:60121270-60121292 CAGGTGATCAAGGGCACCCAGGG + Intergenic
1150300418 17:64043208-64043230 GTGGTGCTCAGGAGCGCCTGGGG - Exonic
1151051794 17:70986345-70986367 CTGGTGATCAGTAGCTTCCAGGG - Intergenic
1152462378 17:80448397-80448419 CTGGGACTCAGGAGAACCCAGGG + Intergenic
1152564375 17:81093560-81093582 CCGGTGCTACGGAGCCCCCATGG - Intronic
1154406404 18:14095907-14095929 CTGGGCCACAAGAGCACCCAGGG - Intronic
1156256814 18:35406180-35406202 CATGTCCTCAGGATCACCCATGG - Intergenic
1157155100 18:45257733-45257755 CTGGTGTTAAGTAGGACCCAAGG + Intronic
1157476268 18:48025466-48025488 CAGGAGATCAGGAGCACCCAGGG + Intergenic
1158718029 18:59898315-59898337 GTGGTGAACAGGAGCACCCTAGG + Intergenic
1159189049 18:65017711-65017733 CTGGTGACCATGACCACCCATGG - Intergenic
1160569136 18:79804491-79804513 CGGGTGCACCTGAGCACCCATGG - Intergenic
1160569137 18:79804494-79804516 TGGGTGCTCAGGTGCACCCGTGG + Intergenic
1160584345 18:79904276-79904298 CTGGGGCTCAGGGGCACCCAGGG + Intronic
1160843871 19:1158200-1158222 CAGGTGCTCAGGGACCCCCAGGG - Intronic
1161453739 19:4360247-4360269 CTTGGGCTCAGGAGCACCTGGGG + Intergenic
1161502527 19:4624448-4624470 CTGGTGCTTACAATCACCCAGGG + Intergenic
1162823072 19:13235108-13235130 CTGGTTCACAGAAGCAGCCATGG - Intronic
1163352979 19:16791021-16791043 CAGGAGCTCAGGAGCAGCCTGGG + Intronic
1164151601 19:22557989-22558011 CAGGGGCACAGCAGCACCCAGGG - Intergenic
1164939811 19:32243682-32243704 ATGGTGCTCAGGGACCCCCAGGG - Intergenic
1168185018 19:54695034-54695056 CTGGTGCCTGGGACCACCCAGGG - Intronic
1168677796 19:58291561-58291583 CAGGTCCTCAGGAACATCCATGG - Intronic
1168699497 19:58428252-58428274 CTAGGCCTCAGGAGGACCCAGGG + Intergenic
925262749 2:2542571-2542593 CTGGCACTCAGCAGAACCCAGGG + Intergenic
925406704 2:3610387-3610409 CTGGTGCTCTGGGGGACCGAGGG + Intronic
926085461 2:10017033-10017055 CTGGAGTTCAGGACCACCGAGGG + Intergenic
928466123 2:31524291-31524313 CTGGTGCTGAGGAATACACAGGG - Exonic
929864846 2:45709209-45709231 GTGCTGGTCAGGAGCACCCTGGG + Intronic
930416283 2:51094443-51094465 CAGGTGCTCAGGTGCTCCCCAGG + Intergenic
932161099 2:69460689-69460711 CAGCTGCTGAGCAGCACCCAGGG - Intronic
933701715 2:85259851-85259873 CCAGTGCTCAGGAACACTCACGG - Intronic
933776699 2:85775398-85775420 CTGGAGCACAGGAGAGCCCAGGG - Intronic
934663462 2:96155106-96155128 CTAGTGCTCAGGAGCGGTCACGG - Intergenic
935079828 2:99781566-99781588 CTGTAGCACAGAAGCACCCATGG - Intronic
935761934 2:106328917-106328939 CTAGTGGGCAGGGGCACCCATGG - Intergenic
937207628 2:120246623-120246645 CTGCAGATCAGGAGCACCCCTGG + Intronic
937237041 2:120437274-120437296 CTGGTGTTCAGGTGCCCACAAGG + Intergenic
940201632 2:151157799-151157821 CTGGAGCTCAGAACCAACCAAGG - Intergenic
946862715 2:224015094-224015116 GTGCTGCTCAGCAGCACCCCTGG - Intronic
948763545 2:240207977-240207999 TGGGTGCTCAGGTGCACCCTGGG + Intergenic
948875198 2:240822754-240822776 CTGGAGGTCAGGGGCACCCAAGG + Intergenic
948930769 2:241130495-241130517 CTAGTGCTGTTGAGCACCCACGG + Intronic
1168903112 20:1382561-1382583 CTGGTACTCAAGAGCACTCTTGG + Intronic
1172700035 20:36847478-36847500 CTAGTCCTCAGCATCACCCAGGG + Intronic
1172834728 20:37865754-37865776 CAGATGCCCAGGAGCAGCCATGG + Intronic
1173014150 20:39209693-39209715 CTTGGGCTCAGGAGCATGCAAGG - Intergenic
1174102651 20:48139006-48139028 GTGGTGCTAAGGAGCATCCAGGG + Intergenic
1174308281 20:49630823-49630845 CGGGTGTTCAGCAGCACCCCTGG - Intergenic
1174503839 20:51004271-51004293 ATGGTCCCCAGGAGCACCCCGGG - Exonic
1175426459 20:58870441-58870463 CTGGTGGGGAGGAGCTCCCATGG - Intronic
1175479572 20:59301611-59301633 GTGGTGCTCAGGGGCCCCCTCGG - Exonic
1175603479 20:60294001-60294023 CTGATGCTCAGAAGAAGCCAAGG + Intergenic
1175766313 20:61595140-61595162 TTTGTGCTCAGGTGGACCCAAGG - Intronic
1175950012 20:62578393-62578415 CTGGTGCCCATTAGCACCAAGGG + Intergenic
1176009676 20:62886171-62886193 CCGGGGCTCAGGAGCAACCAGGG + Intronic
1176024106 20:62977193-62977215 CAGGTGCTCTGGAGCCCCCGTGG - Intergenic
1176587363 21:8600274-8600296 CTGTAGCTCAGGAGCAGCAAAGG - Intergenic
1178240116 21:30889618-30889640 CTGTGGCTCAGGAGCATGCAGGG - Intergenic
1179918396 21:44493325-44493347 CTGCTGCTCAGCATCTCCCAAGG + Intergenic
1180147372 21:45928908-45928930 CTGGGGCTCAGGAGGACCCTGGG - Intronic
1180252583 21:46598835-46598857 CTGGTGATCAGGCGCATCCCGGG + Intergenic
1180270194 22:10577271-10577293 CTGTAGCTCAGGAGCAGCAAAGG - Intergenic
1180348303 22:11723253-11723275 CGGGAGTTCAGGAGCACCCTGGG + Intergenic
1181054450 22:20253523-20253545 CTGGTATCCAGGAGCACCCAGGG + Intronic
1181977145 22:26738115-26738137 CTGGTTCTCATGTGCAGCCAAGG - Intergenic
1183032033 22:35113677-35113699 CTGGTGCTCAGTGGCACCAGGGG - Intergenic
1183032210 22:35114762-35114784 CTGGTGCTCAGTGGCACCACGGG + Intergenic
1183276426 22:36900951-36900973 CTGGGGGTCAGGAGCACCAGGGG - Intergenic
1183460220 22:37945306-37945328 GTATTGCTCAGGAGAACCCAGGG - Intronic
1183887422 22:40896243-40896265 CTCGAGCTCAGGAGCTCACACGG - Intronic
1184130685 22:42514888-42514910 CAGGTGCTAAGGAGATCCCAGGG + Intronic
1184501038 22:44872157-44872179 CAGGTGCTTGGGAGCACACAGGG - Intergenic
1184941275 22:47767223-47767245 ATGCAGCTCAGAAGCACCCAGGG - Intergenic
1185003352 22:48260170-48260192 CTGCTGTTCAGGGGCAGCCATGG + Intergenic
1185122462 22:48980471-48980493 CAGGTGCTCAGGTGGACCCCTGG - Intergenic
1185152237 22:49170607-49170629 CTGCTGGACAGGAGCAGCCATGG - Intergenic
949140056 3:621561-621583 CTGTAGCTCAGGAGCAGCAAAGG + Intergenic
950951410 3:17003882-17003904 GTTTTTCTCAGGAGCACCCATGG + Intronic
955257613 3:57349896-57349918 CAGGTGCTCAAGACCACCCAGGG - Intronic
955495031 3:59522128-59522150 CTGGTGGTCACCAGCACTCATGG - Intergenic
955702243 3:61693517-61693539 TTGGTGCTGAGGAGTACCCAGGG + Intronic
956722549 3:72131204-72131226 CTGGTGCTCCAGAGTAGCCAAGG - Intergenic
966619869 3:181952334-181952356 CTGGTGCCCAGGAGCACCATGGG + Intergenic
968282750 3:197489481-197489503 CTGGGGCTGAGGAGTGCCCAGGG + Intergenic
968622242 4:1609089-1609111 CTCCTGCTCAGGAGCCCCCTAGG + Intergenic
968793851 4:2688758-2688780 ATGGTGCTCAGGATCTCCTAAGG + Intronic
969087320 4:4666130-4666152 CTGGTTCTCAGGAGGACCTTGGG - Intergenic
969202720 4:5618478-5618500 CTGCAGCTCAGGGGCAGCCACGG + Exonic
969245606 4:5930771-5930793 ATGGTGCTCACGTGCTCCCAGGG - Intronic
972396962 4:38665129-38665151 CTGGAGCCCAGGAGCTGCCAGGG + Intronic
982861516 4:160456814-160456836 CTGGAAATCAGGAGCACCAAGGG - Intergenic
983469815 4:168142387-168142409 CTGGTGGTGAGGGGCAGCCATGG - Intronic
984209264 4:176825530-176825552 CTGAAGCTCAGGAGAACCCCTGG - Intergenic
985325331 4:188761782-188761804 CTGGTGCATAGTAGCACCCTTGG - Intergenic
985717781 5:1472245-1472267 CTGGGGGTGAGGAGCACCCAGGG + Intronic
986383234 5:7207242-7207264 GTGGTGCTCAGGAGCAGCTCAGG + Intergenic
993865710 5:93192396-93192418 CTTGGGCTAAGAAGCACCCAGGG - Intergenic
994115918 5:96061253-96061275 CTAGTGCTCAGTAGCAGCCCAGG - Intergenic
997511744 5:134459146-134459168 GGGGAGCTCAGGAGCAGCCAGGG - Intergenic
998095643 5:139394378-139394400 CCGGTGCGCAGGAGCAGCCGGGG + Exonic
999305204 5:150515100-150515122 CACATGCTCAGGTGCACCCAGGG + Intronic
999377008 5:151093909-151093931 CTTGTGCCCAGGGGCAGCCAGGG + Intergenic
1000384749 5:160664221-160664243 CTGGTTCTCAAGAGCAGGCAAGG + Intronic
1000641397 5:163706764-163706786 ATAGTGCTCAGTAGCATCCATGG + Intergenic
1007249681 6:40487330-40487352 CTGGAGCTCAGGTGAAGCCAGGG - Intronic
1012427070 6:99126683-99126705 CTGGTGGTCAGGACCCACCAAGG - Intergenic
1012438992 6:99244823-99244845 CCAGTGCTGAGGAGCAACCAAGG - Intergenic
1013631084 6:111986680-111986702 CTGTGTCTCAGGATCACCCAGGG - Intergenic
1014158468 6:118138790-118138812 CTGGTCTTCAGGAGCACTAAGGG + Intronic
1016199831 6:141394395-141394417 CTGGGGCTCAGAGGCACCCCGGG - Intergenic
1017074674 6:150606801-150606823 CTGGCACTCAGCAGCACTCAGGG + Intronic
1017768390 6:157625527-157625549 CTGATGATCAGTTGCACCCAGGG - Intronic
1017787474 6:157768375-157768397 CTGGGGCTCAGCAGCACCCTGGG + Intronic
1018622663 6:165746608-165746630 CGCGTGCACAGAAGCACCCAGGG - Intronic
1019540265 7:1548123-1548145 CAGGTGCTCAGGAGCTCTCCCGG + Intronic
1020154188 7:5708970-5708992 CTTGTTCTCAGCAGCCCCCAGGG + Intronic
1021962086 7:25883384-25883406 CGGTTGCTCAGGAGCACTAATGG - Intergenic
1022311627 7:29201678-29201700 CTAGTGCTCAATAGCACACATGG + Intronic
1022380084 7:29851449-29851471 CTGGTGAGGAGGAGCAGCCAGGG - Intronic
1022906199 7:34859857-34859879 CTGGTACTTAGGAGCATCCCCGG + Intronic
1023596257 7:41831947-41831969 CTGGTGCTGAGAATGACCCAAGG - Intergenic
1023739737 7:43268640-43268662 CTGACTCTCAGGAGCCCCCAGGG - Intronic
1026010213 7:66629900-66629922 CTGGTGCACAGGGGCTTCCACGG + Intronic
1031986885 7:128168981-128169003 CGGGTGGCCAGGAGCACCCAGGG + Intergenic
1034149750 7:148905613-148905635 CTGGTGCTCAGGAGCAACCTAGG - Intergenic
1034380365 7:150687041-150687063 CTGTTTCTCAGGAACACCAATGG + Exonic
1034421812 7:150994679-150994701 CTGCTGCTCAGGCGCACCCTTGG + Intronic
1034531381 7:151698143-151698165 CTGGTGCCCAGGAGCTCCCTCGG + Intronic
1035433080 7:158837037-158837059 CTGGTCCTCAGGAGCCCCAGCGG + Intergenic
1035479077 7:159167578-159167600 TTGTTGCCCAGGAGCAGCCAGGG - Intergenic
1038427140 8:27471055-27471077 CTGATGCTCAGGAGAAGCCATGG - Exonic
1038576333 8:28706587-28706609 CTGGTGCTAAGCAGGATCCAGGG - Intronic
1041751498 8:61265855-61265877 TTGGTGCACAGGAGCAATCATGG - Intronic
1042510257 8:69603670-69603692 CTGGTTCCCAGAAGCACCCCAGG - Intronic
1043515521 8:80991425-80991447 CTGATGTTCTGGAGCACGCACGG + Intronic
1046510303 8:115193940-115193962 CTGTTGCTCAGAAGCAAGCATGG + Intergenic
1047581853 8:126224419-126224441 CTGGAGCTCACGAGCCCCGATGG - Intergenic
1049426515 8:142540321-142540343 CTGGTTCACAGGAGACCCCAAGG - Intronic
1049536015 8:143182910-143182932 CGGGTGAACAGGAGCCCCCAGGG - Intergenic
1049645735 8:143734871-143734893 CTGGGGGACTGGAGCACCCAGGG - Intergenic
1051102396 9:13535922-13535944 CTGGCCCTGAGGAGCTCCCAGGG - Intergenic
1053924678 9:43040602-43040624 CTGGCTCTCAGGAGCACAAAAGG - Intergenic
1055892921 9:81142267-81142289 CTGCTGCTCAGGGGCACTCAGGG + Intergenic
1056941638 9:90961259-90961281 GTGGTACTCAGGCGCACACATGG - Intergenic
1057049766 9:91914788-91914810 CAGGTGCTCAGGAGCAGGAAGGG - Intronic
1057074714 9:92132414-92132436 CTGGTGCGCATGAGCACTCTTGG - Intergenic
1059194952 9:112362260-112362282 TTGTTGCTCAGGTGCAACCATGG - Intergenic
1060212006 9:121716314-121716336 CTGGTGCTCAGCTGAACCCCAGG + Intronic
1060859136 9:126939511-126939533 CTGGTGCTCAGGAGTACTGGGGG - Intronic
1061092362 9:128433850-128433872 CTGGGGCACAGTAGCACTCAGGG + Intronic
1061856791 9:133445829-133445851 CTGGTCCCCAGGAGCATCCCGGG - Intronic
1062395480 9:136350983-136351005 TTGGTGTTCAGGGGCACCGATGG + Intronic
1062496054 9:136832198-136832220 CTGGTGCCAAGGATCACCCCTGG - Intronic
1062651729 9:137581260-137581282 CTGTTCTTCAGGAGCCCCCAGGG + Intergenic
1203744495 Un_GL000218v1:34503-34525 CAGGAGCTCAGGAGCAACAATGG - Intergenic
1203617322 Un_KI270749v1:77976-77998 CTGTAGCTCAGGAGCAGCAAAGG - Intergenic
1185720164 X:2374861-2374883 CTGGAGTTCAAGACCACCCAGGG + Intronic
1185802509 X:3026662-3026684 TTTGTGCTCAGAAACACCCAAGG + Intronic
1186505741 X:10090574-10090596 CCTTTGCTCAGGAGCACCCTGGG - Intronic
1187878646 X:23825651-23825673 CTTGTGCAAAGAAGCACCCAAGG - Intergenic
1189122713 X:38412242-38412264 CTGGTGCTCAGGCGGATCAAGGG - Intronic
1192181114 X:68916418-68916440 CTGAGGCTCAGGAGCCCCCATGG + Intergenic
1195698304 X:107683038-107683060 CTGGGTATCAGGACCACCCAGGG - Intergenic
1200057915 X:153471041-153471063 CTGGTTCCCAGGAGGACCAAGGG + Intronic
1200067770 X:153512378-153512400 CTGCTGCACAGGGGCAGCCAGGG + Intergenic
1200103864 X:153701731-153701753 TTCGTGCTCAGGCGCAGCCATGG - Intronic