ID: 1122723351

View in Genome Browser
Species Human (GRCh38)
Location 14:103734664-103734686
Sequence CTTTGGTGATGAAGGGAAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 392}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122723347_1122723351 -9 Left 1122723347 14:103734650-103734672 CCATACAGAGGCTCCTTTGGTGA 0: 1
1: 0
2: 1
3: 15
4: 105
Right 1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG 0: 1
1: 0
2: 5
3: 39
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122723351 Original CRISPR CTTTGGTGATGAAGGGAAGA AGG Exonic
903754959 1:25654135-25654157 GTTGGGGGATGAAGGGATGAAGG - Intronic
904564999 1:31423646-31423668 CTTGGGCGGTGAAGGGGAGAGGG + Intronic
904756823 1:32772471-32772493 CATTGCTGATGATGGGAAGTAGG + Intronic
906381766 1:45337006-45337028 GTTTGGCTATGAAGGGAAGGAGG - Intronic
907115882 1:51968063-51968085 CTTTGAAGATGGATGGAAGAAGG + Intronic
908801924 1:67889230-67889252 CTTTAGTGATGATGGTCAGAGGG + Intergenic
910457457 1:87412597-87412619 CCTTGGTCCTGAAGGGAGGAGGG + Intergenic
911251276 1:95579297-95579319 CTCTGGTGATAAAAGGAGGAAGG + Intergenic
911606453 1:99910967-99910989 ATGGGGAGATGAAGGGAAGAAGG - Intronic
912253952 1:108040069-108040091 TTTTTGTCATGAAGGCAAGAGGG - Intergenic
912368784 1:109156797-109156819 CTTTGCTGATAAGTGGAAGATGG - Intronic
914513765 1:148356065-148356087 CTTTGGGGAAGAAGGGCAGGGGG - Intergenic
914972689 1:152325180-152325202 TTTTGGTGAACAAGGTAAGAAGG - Exonic
915484043 1:156207761-156207783 CTTAGGTGGTGAAGGGTGGAGGG + Intronic
915834673 1:159166745-159166767 GTTTGGTTCTGAAGGAAAGATGG - Intergenic
915940389 1:160115137-160115159 GTTTGGAGATGGAGGCAAGAGGG - Intergenic
916159754 1:161897484-161897506 CTTTGGTGCTGAAGGTTAGAAGG - Intronic
916193732 1:162203841-162203863 CTTTGGTCAAGAAGGCCAGATGG + Intronic
916602259 1:166304525-166304547 ATTTGAAGATGAAGGGAATATGG - Intergenic
916891686 1:169117804-169117826 CTGGGGAGATGAAGGGAACAGGG + Intronic
917108619 1:171521322-171521344 CTATGATTTTGAAGGGAAGAAGG - Intronic
917908854 1:179618911-179618933 CTATTGGGATGAGGGGAAGAAGG - Intronic
919072546 1:192774150-192774172 ATTTGCTGATGAAGGGAAGATGG - Intergenic
919618337 1:199835239-199835261 CATTGGTGGTGAAGTGGAGAGGG - Intergenic
919721245 1:200838882-200838904 CTTTGGTGATGAATTGGACATGG + Intronic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
921759826 1:218900017-218900039 CTTTGGAGGTAAAGGTAAGAGGG + Intergenic
921764869 1:218959708-218959730 TTTTGGTGAAGAAGAGTAGATGG + Intergenic
922015538 1:221642380-221642402 ATTTAGTGATGATGGGGAGAAGG - Intergenic
923056478 1:230429930-230429952 TTTGGGTGATGAAGGCAACATGG - Intergenic
923136666 1:231125868-231125890 CTTTGGTGGGGAAGGGAGGTGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923515932 1:234698131-234698153 GTTTGGTGATGAAGAGAAGGAGG - Intergenic
923531744 1:234817534-234817556 CTTTGATGATGGAGGGTGGAGGG + Intergenic
924272725 1:242350524-242350546 CTTTGGTGATAAAGTGAAGCCGG - Intronic
1064091729 10:12391125-12391147 TTTTGGCCATGAAGGGTAGAGGG + Intronic
1064438141 10:15329090-15329112 ATGTGGTGATGTCGGGAAGAAGG + Intronic
1066711986 10:38246123-38246145 CTTTGGTGATCAAGTGAAGCCGG + Intergenic
1067172866 10:43922289-43922311 GTTTGGGGAGGAAGGGAGGAAGG - Intergenic
1067260056 10:44681480-44681502 GTATGGTGATGAAGGCAAGGAGG - Intergenic
1067673261 10:48346080-48346102 ACTTGGGGGTGAAGGGAAGACGG - Intronic
1068349209 10:55821630-55821652 CTTTGGAGATGAAGGAAAACTGG - Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1071094804 10:81960935-81960957 TTTTGGTCATGCAGAGAAGAAGG - Intronic
1073017991 10:100417314-100417336 AGTTGTTTATGAAGGGAAGAAGG + Intergenic
1073383695 10:103103446-103103468 CTTTAATGATGGAGGGAATAGGG - Intronic
1073821119 10:107265159-107265181 CTTTGGGGATTAAAGGAAGCAGG - Intergenic
1074449927 10:113550917-113550939 CATTGGTGATGTGGGGATGAAGG - Intronic
1074898653 10:117798054-117798076 CTTTGGTGCCCGAGGGAAGAGGG - Intergenic
1074908592 10:117886866-117886888 CTTTGGTGATGAAGCAAGGGGGG - Intergenic
1075171632 10:120121005-120121027 GTTTCCTGAGGAAGGGAAGAGGG + Intergenic
1075956048 10:126524235-126524257 ATGTGGTCATGAAGGGAGGAAGG - Intronic
1076602999 10:131671081-131671103 GTTTGCTGAAGAAGGGAAAAGGG + Intergenic
1077078773 11:713356-713378 CTGTGGTGATGAAGGCAGGCAGG - Intronic
1078321016 11:10334656-10334678 CCTTGGGAATAAAGGGAAGATGG + Intronic
1079642822 11:22828618-22828640 GTGTGGTTATCAAGGGAAGAGGG + Intronic
1080093559 11:28377805-28377827 CTTTGATGATGAAGTACAGATGG + Intergenic
1081276976 11:41162262-41162284 TATTGGTGATAAAGGCAAGATGG - Intronic
1082939692 11:58691453-58691475 CTTTGTTGCTGTAGGGAACAAGG - Intronic
1083539988 11:63505947-63505969 CCTTTGTGGTGAAGGGAGGAAGG + Intergenic
1083891486 11:65597982-65598004 CTGGGGTGATGCAGGGAGGAGGG - Exonic
1084030525 11:66478095-66478117 TTCTGGAGATGAAGAGAAGAAGG + Intergenic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1086731830 11:90259561-90259583 ATTTGAGGATGAAGGGAGGAAGG + Intergenic
1087024381 11:93635470-93635492 CATTGGTGAAGAAGGAAAAAAGG - Intergenic
1090096966 11:123751955-123751977 TTTGGGTCATGACGGGAAGAAGG - Intergenic
1090623637 11:128585758-128585780 TTTTAGAGATGAAGGGAAGAAGG + Intronic
1090838494 11:130470801-130470823 CTTTGGTGATGAGGGTGGGAAGG + Intronic
1091135201 11:133182152-133182174 CTTTGGTGAGGCACTGAAGATGG - Intronic
1091174932 11:133549206-133549228 ATTTGGTGGTGATGGGAACAGGG + Intergenic
1092032107 12:5294854-5294876 ATTTGGAGATGAAGGACAGATGG - Intergenic
1092259746 12:6946470-6946492 CTTTGGGGCTGCAGGGAAGCTGG + Intronic
1092998536 12:13973882-13973904 CATTGGTGCCTAAGGGAAGATGG - Intronic
1094526658 12:31235521-31235543 CCTTGGTGAGGGAGGAAAGAAGG + Intergenic
1095120534 12:38412788-38412810 GTTGGGTGATGAATGAAAGATGG - Intergenic
1096588546 12:52642205-52642227 ATTTGGTGAGGAAGAGAAAAAGG + Intergenic
1096716991 12:53497615-53497637 CTGAGGTGATGCTGGGAAGAAGG - Intronic
1097687510 12:62704659-62704681 ATTTGGTGATAAACAGAAGAGGG + Intronic
1097739430 12:63222026-63222048 CCTTGGGGTTGAAGGGAGGAAGG + Intergenic
1100344568 12:93715251-93715273 CTTTGCTGATGAAGTCAGGAAGG - Intronic
1100652501 12:96605755-96605777 CTTAGGTGATGAACGGATGGTGG + Intronic
1101556664 12:105816573-105816595 CTCTTGTGAGGAAGGGATGAGGG + Intergenic
1102176044 12:110875752-110875774 CGTTAGGGATGAAGGGAAGAGGG - Intronic
1102657204 12:114492050-114492072 CTTTGGAGAGGAAGGGGAGTGGG + Intergenic
1102868281 12:116391763-116391785 CCTGGATGATGATGGGAAGAAGG + Intergenic
1103130511 12:118464451-118464473 CTTTGGGGATGCAGGGGAAAGGG - Intergenic
1103288328 12:119822047-119822069 TTTTGGTGATGGAGGGAGGTTGG - Intronic
1104469859 12:129020973-129020995 CTTTGGGGGTGAAGAGAGGAAGG - Intergenic
1106066799 13:26360449-26360471 CTATGAAGATGAAGGGATGAGGG - Intronic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1107021477 13:35756709-35756731 CTTTGGTGGTGAAAGGGAGTGGG - Intergenic
1107589160 13:41883407-41883429 ACTAGGTCATGAAGGGAAGATGG - Exonic
1107717670 13:43216742-43216764 CCTTGGAAATGTAGGGAAGAAGG + Intronic
1110471548 13:75865661-75865683 CTTTGGGGAGGAGGGGAAAAAGG - Intergenic
1110645114 13:77873614-77873636 TGTTGGTGTTGAAGGCAAGAGGG + Intergenic
1110953923 13:81529383-81529405 CTTGGATGATAAAGGCAAGATGG - Intergenic
1112201933 13:97284745-97284767 CTTTGGTACTGAATCGAAGAAGG + Intronic
1112311366 13:98320112-98320134 GTCTGCAGATGAAGGGAAGACGG - Intronic
1112610464 13:100950045-100950067 CTTTGGTGAGGATGGGGAGGAGG + Intergenic
1112730304 13:102353268-102353290 CTTGGATGGTGAAGGGGAGATGG - Intronic
1113439850 13:110319814-110319836 CTTGGGAGGAGAAGGGAAGAGGG - Intronic
1114241913 14:20875908-20875930 CTTTAGTGATGAGGAGTAGAAGG - Intergenic
1114248501 14:20936473-20936495 CTTTAGTGATGAGGAGTAGAAGG - Intergenic
1115243288 14:31270353-31270375 CTCTGCTGGTGGAGGGAAGAGGG - Intergenic
1115668243 14:35578061-35578083 ATTTGGTTATGAATGAAAGAAGG - Intronic
1115750021 14:36479997-36480019 ATTTGGGGGTGAAGGAAAGAAGG - Intronic
1116883004 14:50190961-50190983 CTCTGGTGGGGAAGAGAAGAGGG - Intronic
1117282448 14:54254168-54254190 CTTGAGTGAGGAGGGGAAGAAGG - Intergenic
1117391607 14:55267966-55267988 CATTGGTGATGACGGGGGGATGG - Intergenic
1117962761 14:61179153-61179175 CTCTGGGGATGAAGGGATGGGGG + Intergenic
1118614622 14:67566921-67566943 CTCTGGTGATGAAGGTATTAAGG + Intronic
1119394325 14:74315042-74315064 CTTGGGAGAGGAAGGGAAGCAGG + Intronic
1120492818 14:85198165-85198187 CTTTGACTATGAAGGGAAGCCGG + Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1121510697 14:94510923-94510945 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1122613969 14:103004187-103004209 CTTGGGAGAGGAAGGGATGAGGG - Intronic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1123424300 15:20156807-20156829 GTTTGGAGAGGAAGGAAAGAAGG + Intergenic
1123533522 15:21163336-21163358 GTTTGGAGAGGAAGGAAAGAAGG + Intergenic
1125790362 15:42360995-42361017 CTAGGGTCCTGAAGGGAAGATGG + Intronic
1126066623 15:44830676-44830698 CTTAGGAGAGGAAGGGAAGGAGG - Intergenic
1126093259 15:45070193-45070215 CTTAGGAGAGGAAGGGAAGGAGG + Intronic
1126445366 15:48737189-48737211 CTTAGGTGGTGATGGGGAGACGG - Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127630309 15:60821444-60821466 TTTGGGTGGTGAAAGGAAGAAGG - Intronic
1128255645 15:66194649-66194671 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1129443639 15:75600687-75600709 CTTTGGTGAGGAAAGGATTAGGG + Intronic
1129693065 15:77724648-77724670 CTATGGTGAGGAATGGATGAGGG + Intronic
1130710417 15:86275163-86275185 TTTTGGTGCTGAAGGGCAGAGGG + Intronic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1133301286 16:4784216-4784238 CTCTGATGATGCAGGGAAGTGGG - Intronic
1134140261 16:11712399-11712421 CTTAGGTGGAGACGGGAAGATGG - Intronic
1134222634 16:12367036-12367058 CTTGGATGATGAAGGGGAGATGG - Intronic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135193448 16:20374537-20374559 AATTGCTGATGAAGGGTAGAAGG + Intronic
1135323227 16:21510534-21510556 CTCAGGTCATGATGGGAAGAAGG + Intergenic
1135665109 16:24329048-24329070 CTTGGGTGAAGAAGGGAAACAGG - Intronic
1135680749 16:24454683-24454705 CATTGGTGGTGAAGGGTGGAGGG - Intergenic
1136334711 16:29603721-29603743 CTCAGGTCATGATGGGAAGAGGG + Intergenic
1136860563 16:33699080-33699102 ATTTGGAGAGGAAGGAAAGAAGG - Intergenic
1138309594 16:56011952-56011974 CGTTGGTGGTGAGGGGATGATGG - Intergenic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1140998641 16:80286703-80286725 TTTTGGTGAGGAAGGGTAGAAGG + Intergenic
1141531726 16:84650863-84650885 CTTTAATGATGGAGGGAAGCAGG + Exonic
1203122063 16_KI270728v1_random:1547263-1547285 ATTTGGAGAGGAAGGAAAGAAGG - Intergenic
1143539097 17:7558940-7558962 CAGTGGTGCAGAAGGGAAGAAGG - Exonic
1143805216 17:9420613-9420635 GGTTGGTGTTGAAAGGAAGAAGG - Intronic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1144098462 17:11922994-11923016 CTTTGGGAATTAAGTGAAGAGGG + Intronic
1144192521 17:12859483-12859505 CTTAAGTGATGATGAGAAGATGG - Intronic
1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG + Intronic
1144791496 17:17862046-17862068 CTTTGGTGGTGAAGGGTACATGG + Intronic
1144875781 17:18396457-18396479 CTTTGGGAAGGAAGGAAAGAAGG - Intergenic
1145156447 17:20547964-20547986 CTTTGGGAAGGAAGGAAAGAAGG + Intergenic
1145965104 17:28911393-28911415 GTGTGGTGAGGAAGGGCAGATGG + Intronic
1146488236 17:33261281-33261303 AGTGGGTGATGAGGGGAAGATGG - Intronic
1146664555 17:34688992-34689014 CTAGGTTGATGAAGGAAAGAAGG + Intergenic
1147745940 17:42694658-42694680 CCATGGTGATGGTGGGAAGATGG - Intronic
1148103366 17:45106210-45106232 CTTTGAGAAGGAAGGGAAGATGG + Exonic
1149037972 17:52156911-52156933 CTTTGTTGATGCAGGGAATTGGG - Intronic
1149309785 17:55382771-55382793 CCTTGGTTATGAAGGGAAAGAGG - Intergenic
1149436664 17:56639272-56639294 GCTGTGTGATGAAGGGAAGATGG - Intergenic
1150066344 17:62112731-62112753 ATCTGATGATGAAGGGCAGAGGG - Intergenic
1150628580 17:66859672-66859694 CTTTTGGGGTGAAGGGAGGAAGG - Intronic
1152506900 17:80755298-80755320 AGTTGGAGATGAAGGGAAGAGGG + Intronic
1152862250 17:82703221-82703243 CTCTGCTTCTGAAGGGAAGAGGG - Intergenic
1153581157 18:6575104-6575126 ATTTAGGGATGAAGGGAATAGGG - Intronic
1153859364 18:9185334-9185356 CTTTTGGGATGAAGAGAAGTTGG + Intronic
1154336667 18:13471431-13471453 CTTTCGTAATGGAGAGAAGAGGG + Intronic
1154507450 18:15056599-15056621 CTTTGAAGATAAAGGCAAGAAGG + Intergenic
1155506099 18:26534896-26534918 CTTTGGTGATGAGAGTAAAAGGG - Intronic
1156525112 18:37759647-37759669 CTGTGGTGATGTGGGGTAGATGG - Intergenic
1158907658 18:62029553-62029575 ATTTAATGAGGAAGGGAAGAGGG + Intergenic
1159665999 18:71161192-71161214 ATTTTCTGATTAAGGGAAGATGG - Intergenic
1161839718 19:6672201-6672223 CTTTGGAGATCTAGGGAAGATGG - Intergenic
1162863668 19:13527276-13527298 CTTTTTTGATGAAGGAAGGAAGG - Intronic
1164404546 19:27932356-27932378 CTTGGTAGATGAAGAGAAGAAGG - Intergenic
1167414537 19:49363144-49363166 CTTTGGTGCCTGAGGGAAGATGG + Intronic
1167427023 19:49434587-49434609 CTTTTGTGGTGAGAGGAAGAGGG - Exonic
925116377 2:1381981-1382003 CTTTCATGAGGATGGGAAGATGG + Intronic
925326743 2:3028284-3028306 GATTGATGATGAATGGAAGATGG + Intergenic
926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG + Intergenic
928458549 2:31448249-31448271 CTTTGGTGAGGGGAGGAAGATGG + Intergenic
929262766 2:39884019-39884041 CTATGAGGCTGAAGGGAAGATGG + Intergenic
929464832 2:42134993-42135015 CTGTGGTGATGAAGGGTTGTGGG + Intergenic
929573911 2:43040325-43040347 TTTGGGTGATGAGGGGGAGAGGG + Intergenic
929774063 2:44917152-44917174 GTTTTATGATGAAGGGAAGCAGG + Intergenic
929840923 2:45462219-45462241 TTTTGGTGATGAAGGAAATGAGG - Intronic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930269614 2:49241022-49241044 CTTTGGTGCTGAAGGGAGAAGGG + Intergenic
930836357 2:55797962-55797984 CTTTGGGGATGTAGGGGAAAGGG + Intergenic
931746838 2:65298378-65298400 CTTTGGTGATCTAGGCATGAAGG - Intergenic
934524797 2:95045156-95045178 TTTTTCTGATGAAGGCAAGAAGG - Intronic
934780423 2:96966297-96966319 CTCTGATGATGAAGGGATGTGGG - Intronic
936676467 2:114721554-114721576 ATTGGGTGATGAAGAGAAGCAGG - Intronic
937104108 2:119294382-119294404 ATTTGGCTGTGAAGGGAAGATGG + Intergenic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
940472601 2:154117426-154117448 CTTTGGAGATGCAGGGTAAAGGG - Intronic
941318294 2:164022453-164022475 GTTGGGTGATGAAGGGAGGCTGG + Intergenic
943368303 2:186985368-186985390 ATAAGGTGATGAAGGTAAGAAGG - Intergenic
943572749 2:189593202-189593224 CTTTGGGGATAAGGGGGAGAGGG + Intergenic
945405380 2:209441475-209441497 CTTTGGAAAAGAAGGGAAAAAGG + Intronic
946071629 2:217039221-217039243 CTTAAGGGATGAAGGGAATATGG - Intergenic
946086563 2:217179351-217179373 CTTTGAAGATGGAAGGAAGATGG + Intergenic
946193420 2:218019674-218019696 TTCTGTTGATGAAAGGAAGAAGG + Intergenic
946204666 2:218095329-218095351 TTTTGGTGATGCAGGGAAGAAGG - Intergenic
946388623 2:219401876-219401898 GTTTGATCATGAAGGGAAGGAGG + Intergenic
947093668 2:226542287-226542309 CATTGGTGAGGAGGGGAAAATGG + Intergenic
947231173 2:227888263-227888285 GTTTGTTGATGAGGTGAAGAGGG + Intronic
947541826 2:230985176-230985198 CTTTGGAGATGAAGGGAGGGAGG + Intergenic
947860723 2:233355190-233355212 CTTTTGGGATGAAGGGGTGAAGG - Intronic
947996678 2:234533835-234533857 CTTTGGTGAGGAAGGAAAGATGG + Intergenic
1169349359 20:4855734-4855756 GTTTTGTGAAGAAGGGAAGCTGG - Exonic
1169533405 20:6509780-6509802 TTTTGGGGGTGATGGGAAGAGGG + Intergenic
1172791771 20:37510784-37510806 CTGTAGTCATGAGGGGAAGAAGG - Intronic
1174894239 20:54431487-54431509 CTTTAGTGATGATGGCAAGCCGG - Intergenic
1175596058 20:60233901-60233923 GTTTGGTGATCAAGGAAAGGTGG - Intergenic
1176271386 20:64236712-64236734 CTTTTGTGCTGGTGGGAAGAAGG + Intronic
1176298735 21:5088511-5088533 CTGGGGTGGTGAAGGGGAGAGGG - Intergenic
1176790627 21:13315168-13315190 CTTTGAAGATAAAGGCAAGAAGG - Intergenic
1177113430 21:17056717-17056739 CTTTGTTCATGAAGGGATGTTGG + Intergenic
1177576575 21:22964307-22964329 CATTGTTGCTGAAGGGAAGGGGG + Intergenic
1177786592 21:25678282-25678304 CTTCAGTGAGGTAGGGAAGACGG - Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179858291 21:44173438-44173460 CTGGGGTGGTGAAGGGGAGAGGG + Intergenic
1182299888 22:29331449-29331471 CTTTGTGGAGGACGGGAAGATGG - Exonic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1182688984 22:32143149-32143171 CCTTGGTGGTGAAGGAAGGAAGG - Intergenic
1183405927 22:37630543-37630565 CTTTGGTGATGGAGAGATCAGGG - Intronic
949220229 3:1624451-1624473 CTTTGATGATGAATGGATGAAGG + Intergenic
949517817 3:4822874-4822896 CTTGGCAGATCAAGGGAAGAGGG + Intronic
950623709 3:14228616-14228638 ATTTACTGATGAGGGGAAGAAGG + Intergenic
951752545 3:26053703-26053725 TTTTGGTGATGAAGGGAAAAAGG + Intergenic
951774098 3:26289245-26289267 AACTGATGATGAAGGGAAGAAGG + Intergenic
952854185 3:37754169-37754191 CATGGCTTATGAAGGGAAGAGGG + Intronic
953315755 3:41925096-41925118 CTTTGGAGATGCTGGCAAGACGG + Intronic
953343037 3:42151519-42151541 CATTTTGGATGAAGGGAAGAAGG + Intronic
953782431 3:45883500-45883522 GTCTGGTGATTAAGAGAAGATGG + Intronic
955878971 3:63523504-63523526 CTTTGGTGATTAGGGGCAAAGGG - Intronic
956515492 3:70042017-70042039 CTTTTTTGAAGGAGGGAAGATGG + Intergenic
957154024 3:76523697-76523719 CTTTTCTGGTGATGGGAAGAAGG + Intronic
957192797 3:77031312-77031334 CAATGGGGATGATGGGAAGATGG + Intronic
957793607 3:84972209-84972231 CTTTGGTGATGTATTGTAGAAGG + Intronic
958813760 3:98893072-98893094 AATTGGGGATAAAGGGAAGAGGG + Intronic
959988092 3:112599276-112599298 ATTTGGTGATGAGGGGCAAAGGG - Intergenic
961341477 3:126224935-126224957 CGGTGGTGACCAAGGGAAGAAGG + Intergenic
961414517 3:126747752-126747774 CTCTGGAAATGAAGGGAAGGAGG - Intronic
961472773 3:127126879-127126901 CTTTGTGGGAGAAGGGAAGAGGG - Intergenic
961746132 3:129064560-129064582 CTTTGGCAATGAGAGGAAGAGGG - Intergenic
963642618 3:147878259-147878281 TTATGGTGAGGAAGAGAAGAAGG + Intergenic
964755707 3:160089276-160089298 ATAAGGTGATGAAGGCAAGAAGG - Intergenic
964871033 3:161313994-161314016 CTTTCTTGATGAAAGGAATATGG + Intergenic
965481454 3:169224216-169224238 TGTTGGTGATGAAGGGCAGATGG - Intronic
965493202 3:169365598-169365620 TTTTGGAGATGAAGGCAAAATGG + Intronic
965983817 3:174726674-174726696 GTTTGATGATGAAGGAAGGAAGG - Intronic
967701064 3:192592729-192592751 CTCTGGAGATAAAGAGAAGATGG - Intronic
967955890 3:194876918-194876940 CTTGGGGGATGCAGGGAAGCTGG + Intergenic
968002286 3:195214345-195214367 GTTGGCTGATGCAGGGAAGAGGG - Intronic
969535227 4:7752504-7752526 CAGTGGTGATGAAGGGATCAGGG - Intergenic
969546635 4:7834342-7834364 CTTTGGGGATTCAGGGAAAAAGG + Intronic
970120185 4:12745180-12745202 CTCTGGTTGGGAAGGGAAGAAGG - Intergenic
970143019 4:13003215-13003237 CTTTGGAGATGGAGGAATGAAGG - Intergenic
970225273 4:13850932-13850954 CTTTTGTAATGAAGTCAAGAGGG - Intergenic
970369801 4:15395254-15395276 CTGGGGTGATTTAGGGAAGAGGG + Intronic
970425979 4:15946751-15946773 CTTACGTGATGGAGGCAAGATGG + Intergenic
970721422 4:18993728-18993750 CTATGGTGATGAAGAGAGCATGG - Intergenic
971555399 4:28007611-28007633 CTTTGGAGAAGACGGGGAGACGG + Intergenic
971587718 4:28426114-28426136 CATTGGTGATTCATGGAAGAAGG - Intergenic
972248050 4:37267086-37267108 ATGTGGTCATAAAGGGAAGAAGG + Intronic
972605973 4:40614247-40614269 ATTTGATGTTGAAGGGAAGATGG - Intronic
972676829 4:41268103-41268125 TTTTCATGTTGAAGGGAAGAGGG - Exonic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973185411 4:47322115-47322137 CTTTTGTGGGGAAGGGATGAGGG + Intronic
973236800 4:47914393-47914415 CTTTGGAGATGGACCGAAGAGGG + Exonic
973645923 4:52951187-52951209 CTTTGGTGAGTCAGGGAGGAAGG - Intronic
976200731 4:82575821-82575843 CTTTTGTCATGAAGGGCTGATGG + Intergenic
976776272 4:88709695-88709717 CATTGGTAATGAAGGGGAAAAGG - Intergenic
979809914 4:125024404-125024426 TCTTGGTGATGCAGGGTAGATGG + Intergenic
981010278 4:139918321-139918343 GTGTGGTGGTGAAGGGGAGAAGG - Intronic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
982916366 4:161214595-161214617 CTTTGGTGTTGGGTGGAAGAGGG - Intergenic
984900625 4:184583082-184583104 CATTGGTGATGAATTGTAGAAGG - Intergenic
986082646 5:4410181-4410203 ATTTGCTGATGTGGGGAAGATGG + Intergenic
986548662 5:8927644-8927666 CTTGGGTGCTGGAGGAAAGAAGG + Intergenic
987020285 5:13863552-13863574 ATTCGGTGATGAAGGGAACATGG - Intronic
987695596 5:21325593-21325615 CTTTTGCTATGAAGGGATGATGG - Intergenic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
990240731 5:53813730-53813752 CTTTCCTGATGAAGAAAAGAGGG + Intergenic
990431411 5:55738418-55738440 TTTTAGTGGGGAAGGGAAGAAGG - Intronic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991122278 5:63030505-63030527 CTTCATTGATGGAGGGAAGAAGG - Intergenic
991208129 5:64073484-64073506 CATTGGACATGAAGGGAGGAAGG - Intergenic
991499495 5:67262956-67262978 CTCTGGGGCTGAAGGTAAGAAGG + Intergenic
991719115 5:69479404-69479426 CTATACTGATGAAGGGAAGAAGG + Intergenic
991744807 5:69726505-69726527 CTTTTGCTATGAAGGGATGATGG + Intergenic
991752898 5:69828721-69828743 CTTTTGCTATGAAGGGATGATGG - Intergenic
991796377 5:70306233-70306255 CTTTTGCTATGAAGGGATGATGG + Intergenic
991802516 5:70385455-70385477 CTTTTGCTATGAAGGGATGATGG - Intergenic
991824187 5:70601819-70601841 CTTTTGCTATGAAGGGATGATGG + Intergenic
991832217 5:70703849-70703871 CTTTTGCTATGAAGGGATGATGG - Intergenic
991888755 5:71305789-71305811 CTTTTGCTATGAAGGGATGATGG + Intergenic
992230617 5:74659920-74659942 CCTTGAGGATGAAGGGCAGAAGG + Intronic
992658603 5:78935769-78935791 CTTTGCTGATGAAGAAAATAAGG + Intronic
992778029 5:80105225-80105247 CCTTGGTGGTGTGGGGAAGAAGG - Intergenic
992849714 5:80794667-80794689 CTTTGGAGATGAAGAGATCAAGG + Intronic
994497043 5:100526035-100526057 CTTTGGAGATGTAGGGGAAAGGG + Intergenic
994753589 5:103767803-103767825 CATTTGTGAAGGAGGGAAGAGGG - Intergenic
994870799 5:105348262-105348284 CTTTGGTGAGGAAGAGGAGGGGG - Intergenic
995191890 5:109326679-109326701 CCTGGCTGATGAAGGAAAGAAGG + Intergenic
995947970 5:117672906-117672928 CTTTGGCTGTGAAGGGAAAAGGG - Intergenic
996088745 5:119329992-119330014 CATTGGTGAAGCAGGGAGGAAGG - Intronic
996579041 5:125009518-125009540 ATTTGGTTGTGAATGGAAGATGG + Intergenic
996858406 5:128036683-128036705 TTCTGGTGAAGAAAGGAAGATGG - Intergenic
998098696 5:139413802-139413824 CTTCACTGAAGAAGGGAAGAAGG + Exonic
998471328 5:142386228-142386250 CCATGGGGATGAAGGGAAGGAGG + Intergenic
999349217 5:150851230-150851252 CGTTGGTCTTGAAGGGAAGATGG + Intronic
999445426 5:151634948-151634970 TTATTGTGATGAAGGAAAGAAGG + Intergenic
1000355936 5:160395894-160395916 CTTTGGGGCTGAGTGGAAGAAGG - Intronic
1000372922 5:160554516-160554538 CTTTAGTGATGTAGGGAAGGAGG + Intergenic
1003120826 6:3318009-3318031 CTCTGGTGATGCAAGGAAGATGG - Intronic
1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG + Intergenic
1003939475 6:11009945-11009967 GACTGGTGATGAAGGAAAGATGG + Intronic
1004521604 6:16366134-16366156 CTTTGGTGATATATGGAAAAGGG + Intronic
1005062318 6:21788339-21788361 CTTTGTTGCTGAAGGTATGAAGG + Intergenic
1005555187 6:26972473-26972495 CTTTTGCTATGAAGGGATGATGG + Intergenic
1005949731 6:30622905-30622927 CTCTGGTGGTGCAGGGATGATGG - Intronic
1006479728 6:34282276-34282298 CTTTGGTGCTGAATTGAAAATGG - Exonic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006919378 6:37617383-37617405 ATTTGGTGAGGAAGGAAGGAAGG - Intergenic
1007455049 6:41970658-41970680 CTTTGGTGAAGAGGGAAGGATGG - Intronic
1008043423 6:46827380-46827402 CTCTGGAGAGAAAGGGAAGATGG - Intronic
1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG + Intronic
1009518590 6:64653036-64653058 CTTTGCCGATGAAAGTAAGATGG + Intronic
1010360021 6:74982314-74982336 CTCTGGTGATGAAGTGGTGATGG + Intergenic
1011293817 6:85806131-85806153 CTTTTTTGTTGAAGGGATGAAGG + Intergenic
1011383687 6:86770297-86770319 TTTTTATCATGAAGGGAAGATGG - Intergenic
1011542373 6:88445648-88445670 CTCAGCTGATGAAGGGAAGCAGG - Intergenic
1012433734 6:99192933-99192955 CTTTGGTGAAAGAAGGAAGAAGG - Intergenic
1012692829 6:102336399-102336421 CTTTGAAGATGGAAGGAAGAGGG - Intergenic
1014450690 6:121578037-121578059 TTTTATTGCTGAAGGGAAGATGG + Intergenic
1017087396 6:150726677-150726699 ATTTGGTGATGAAGGAACCAAGG - Intronic
1018605308 6:165591477-165591499 CTTGGGTTTTGAAGGGAAGATGG - Intronic
1018766250 6:166935422-166935444 CTTGGGTGATCAAGGGAATACGG + Intronic
1019169297 6:170122843-170122865 CTTTGAAGATAAAGGGAGGAGGG + Intergenic
1019557442 7:1639799-1639821 CTTTGGTGTCGTAGGGAAGGGGG + Intergenic
1019612820 7:1945580-1945602 CCCTGGAGATGAAGGGAAGGAGG + Intronic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1020263894 7:6547644-6547666 CTTTGGTGATGTAGGGAAGCTGG + Intronic
1021402790 7:20228835-20228857 CTTTGGGGATAATGGAAAGAGGG + Intergenic
1023352146 7:39331408-39331430 CATTGGTGAGGACGTGAAGAGGG - Intronic
1023630277 7:42156819-42156841 CTTTGCTGGTGATGGGAGGAGGG - Intronic
1024544899 7:50508924-50508946 CTTTCTTGTTGGAGGGAAGAGGG - Intronic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1026619965 7:71941688-71941710 CTTTTGTGCTGCTGGGAAGAGGG + Intronic
1026852645 7:73734875-73734897 CTCTTGTGGTGAAGGGAGGAAGG + Intergenic
1028776264 7:94680619-94680641 ATTTGGTGCTGAAGGGATGATGG + Intergenic
1028811256 7:95089554-95089576 CTTTGGAGATTCTGGGAAGATGG + Intronic
1029411307 7:100413130-100413152 CTTTGGTGATTAATTGGAGATGG - Intronic
1029885161 7:103861837-103861859 GTTTGGTGATGAAGGAAAGCTGG + Intronic
1030535552 7:110762046-110762068 CTTTGGAAAGGAAGGGATGATGG - Intronic
1030988777 7:116274206-116274228 GGTTGGTGAAGAAGGGAAGTGGG + Intergenic
1032066120 7:128772720-128772742 CTTTGGTGATACAGAGAATAAGG - Intronic
1033437302 7:141344635-141344657 GTCTTTTGATGAAGGGAAGAAGG - Intronic
1033473786 7:141671559-141671581 CCTAGGAGATGCAGGGAAGAGGG - Intronic
1034113301 7:148559386-148559408 CTATGGGGAAGAAGGGAATAGGG - Intergenic
1034309203 7:150072015-150072037 GCTTTGTGAAGAAGGGAAGAGGG + Intergenic
1035149349 7:156854643-156854665 CTTAGGTGAAGAAGGCTAGAGGG - Intronic
1037588044 8:20291396-20291418 CTTTGGAACTGAGGGGAAGAGGG + Intronic
1037889161 8:22614201-22614223 CTTGGATGATGGAGGGAAAAGGG - Exonic
1038024237 8:23574664-23574686 CTTTGGAGATAAAGGCCAGATGG - Exonic
1039069634 8:33637688-33637710 GTTGGGTGATGAAAGGAGGAAGG + Intergenic
1039287427 8:36057359-36057381 CCTTGGTGATGAAAGGAAAAAGG - Intergenic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1040542512 8:48372782-48372804 CTTTGGTGTCGATGGGGAGAGGG + Intergenic
1041387386 8:57318912-57318934 CCTTGGTGACAAAGAGAAGATGG + Intergenic
1041703387 8:60817362-60817384 TTTTGGAGATGAAGGAAAGTGGG + Intronic
1041778916 8:61556355-61556377 TTTTAGTGATCAAGGGAAAATGG + Intronic
1041913380 8:63113844-63113866 CTTCAGAGATGAAGGAAAGAAGG + Intergenic
1044426486 8:92057250-92057272 CTTTTGTAATGAAGGCTAGATGG - Intronic
1044857880 8:96494491-96494513 CTTTTCTGAGGAAGGGAAGAGGG - Intronic
1046719167 8:117599551-117599573 TTTTTGTGAGGGAGGGAAGAAGG - Intergenic
1046975244 8:120267860-120267882 CTTTGGTGAAATAGGGAGGATGG + Intronic
1047706409 8:127504111-127504133 CTTTGATGATTTAGGGTAGACGG - Intergenic
1047784603 8:128141801-128141823 GTTTGGTGATGGAGGCAAGAGGG + Intergenic
1048263101 8:132962103-132962125 TGGTGGTGATGAAGTGAAGAAGG + Intronic
1049250553 8:141586631-141586653 CTTAGGTCATGACGGGAAGCAGG - Intergenic
1050261356 9:3843851-3843873 GTTTGGTGATGAACGTAAGAAGG + Intronic
1050395383 9:5189385-5189407 CTTTGCAGAGGAAGGGATGAGGG + Intergenic
1051191361 9:14516386-14516408 TTTTTGTGATCAAGGAAAGAAGG - Intergenic
1052457454 9:28718524-28718546 ATGTTGTGATGAAGGGGAGAAGG - Intergenic
1052733396 9:32315651-32315673 GTTGGGGGAAGAAGGGAAGAAGG + Intergenic
1054751613 9:68912849-68912871 CTTTAGTCATGAAGAGAGGATGG + Intronic
1055347335 9:75352697-75352719 CTTTGGAGATGAAGAGTAAAGGG + Intergenic
1055937213 9:81614361-81614383 CTTTGGTTATGTAGGCAAGTGGG - Intronic
1056023204 9:82463457-82463479 GTTGGGTGAGGAAGGGGAGAAGG - Intergenic
1056055758 9:82822042-82822064 CGTTTGTGATGTAGGGGAGAGGG + Intergenic
1056806573 9:89733427-89733449 CCTTGCTGATGAAGTGAAGAGGG + Intergenic
1057254619 9:93534830-93534852 CTTTGTTGGTGAAGGCAGGAAGG + Intronic
1058447057 9:105063920-105063942 CTTTGTTTATGAAGGGAATGGGG - Intergenic
1058944853 9:109846622-109846644 CTTTGCAGATGAAGGGATTAAGG - Intronic
1059794677 9:117680044-117680066 CTTTGGTCCTCAAAGGAAGAAGG - Intergenic
1059835351 9:118146152-118146174 CTTTGGAGATGAGGAGAATATGG + Intergenic
1060558925 9:124526878-124526900 ATTTAGTGATGAAGGGATGGAGG - Exonic
1060654376 9:125358978-125359000 CTTTGTAGATGAAGAGAAGTAGG - Intronic
1060786766 9:126457224-126457246 TGTTGGTGATGGAGGGAAGAAGG - Intronic
1060972317 9:127745219-127745241 CTCTGGTGATGCAGGGAGGTGGG - Intronic
1061533217 9:131230810-131230832 CTTTGGGGGAGAAGGCAAGAGGG - Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1062266682 9:135689732-135689754 CTTTGGTGAGGGAGGTGAGAGGG - Intergenic
1186481746 X:9901487-9901509 CCTTTAAGATGAAGGGAAGAGGG + Intronic
1186848505 X:13555373-13555395 CTTTGGAGATGAGAGGAAGAAGG + Intergenic
1186866236 X:13723505-13723527 TTTTGTTGGTGAAGGGAAGGTGG - Intronic
1186897638 X:14020359-14020381 CTTTGGGGAAGAAGCGCAGAAGG + Exonic
1187662768 X:21568600-21568622 TTTTTTTGATGGAGGGAAGAGGG + Intronic
1188278422 X:28231742-28231764 CTATGGTGAAGAAGGGAAATTGG - Intergenic
1189150746 X:38703798-38703820 CTTTGGGGAAGAAGAAAAGAAGG + Intergenic
1191595235 X:62936242-62936264 CTTCGCTGGTGAAGGGCAGAGGG + Intergenic
1191796402 X:65026189-65026211 CTTTGGGGAGGAAGGAATGAAGG + Intronic
1191921705 X:66263654-66263676 CTTTGGTGATGACGGTGAGAGGG - Exonic
1191988894 X:67010673-67010695 GTCTGGTGATGAACGGAAGTGGG - Intergenic
1192268728 X:69558337-69558359 CTTTGGGTCTGAAGGCAAGATGG + Intergenic
1192418832 X:71010386-71010408 CTTTGGTGACTAAGTGAATATGG - Intergenic
1192679941 X:73241950-73241972 CTGTGATGGTGATGGGAAGAGGG + Intergenic
1193865235 X:86722234-86722256 CTTTTATCATGAAGGGAAGTTGG + Intronic
1196700019 X:118658186-118658208 CTTTGATAATGAAGCCAAGAGGG + Intronic
1197703849 X:129619549-129619571 CTTTGGCCAGGAAGGAAAGAAGG - Intergenic
1198164186 X:134037367-134037389 CTTTGGTGATGATGAGAGGCAGG - Intergenic
1198676199 X:139133760-139133782 CTTTGGAGATGAAGAGAGCAAGG - Intronic
1198677851 X:139149886-139149908 CTCAGGTGATAATGGGAAGAAGG + Intronic
1199411167 X:147525195-147525217 CTTTGGTGGAGGTGGGAAGAGGG - Intergenic
1200781591 Y:7221151-7221173 GTTGGGTGATGAAGGGAGGGAGG + Intergenic
1201594268 Y:15650453-15650475 CTTTTGAGATGAAGTGGAGAAGG - Intergenic
1201787673 Y:17803550-17803572 TTTTGTTGGTGAAGGGAAGGTGG - Intergenic
1201813880 Y:18102438-18102460 TTTTGTTGGTGAAGGGAAGGTGG + Intergenic
1202305942 Y:23470809-23470831 TGTTGGTGATGACGGGGAGAAGG + Intergenic
1202564867 Y:26199780-26199802 TGTTGGTGATGACGGGGAGAAGG - Intergenic