ID: 1122724863

View in Genome Browser
Species Human (GRCh38)
Location 14:103743780-103743802
Sequence CTCGTCATGTGCTATGAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122724863_1122724870 18 Left 1122724863 14:103743780-103743802 CCGGACTCATAGCACATGACGAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1122724870 14:103743821-103743843 TCTGAGCGCCTGGGCAACACAGG 0: 1
1: 0
2: 0
3: 13
4: 145
1122724863_1122724868 8 Left 1122724863 14:103743780-103743802 CCGGACTCATAGCACATGACGAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1122724868 14:103743811-103743833 CCGGCTGCGCTCTGAGCGCCTGG 0: 1
1: 0
2: 5
3: 36
4: 132
1122724863_1122724869 9 Left 1122724863 14:103743780-103743802 CCGGACTCATAGCACATGACGAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1122724869 14:103743812-103743834 CGGCTGCGCTCTGAGCGCCTGGG 0: 1
1: 0
2: 0
3: 18
4: 115
1122724863_1122724871 19 Left 1122724863 14:103743780-103743802 CCGGACTCATAGCACATGACGAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1122724871 14:103743822-103743844 CTGAGCGCCTGGGCAACACAGGG 0: 1
1: 0
2: 1
3: 12
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122724863 Original CRISPR CTCGTCATGTGCTATGAGTC CGG (reversed) Intronic
902693514 1:18125351-18125373 CTCTTCATGTCCCCTGAGTCTGG + Intronic
914351018 1:146840586-146840608 CTGCTCATGGGCTTTGAGTCTGG - Intergenic
914718669 1:150271508-150271530 CTCAACATCTACTATGAGTCAGG - Intronic
923271046 1:232355272-232355294 CTAGTCATGTGCTCAGTGTCTGG - Intergenic
923355628 1:233152274-233152296 GTCATCATGTGCTATGATACTGG - Intronic
1070677477 10:78422042-78422064 GTAATCATGTGCTCTGAGTCAGG + Intergenic
1076010814 10:126986540-126986562 CTGGGCATGTGCTCTGGGTCAGG - Intronic
1078655774 11:13237692-13237714 CTGATCATGTGCTATGTGTCAGG - Intergenic
1079774628 11:24509075-24509097 CGCGACATGTGCGATGAGTGAGG + Intronic
1084080526 11:66820993-66821015 CTGTTCATGTGCTTTGAGTCAGG - Intronic
1093065541 12:14654380-14654402 CTCATCAGGTGCTAAGAGTCAGG - Intronic
1104017479 12:124970752-124970774 CTCCACATGTGCCATGAGCCTGG - Intronic
1113292807 13:108924775-108924797 CACGTCTTCTGCTATCAGTCAGG + Intronic
1114948757 14:27719814-27719836 CTCTACATCTGCTATGAGACAGG - Intergenic
1117076125 14:52106661-52106683 CTCCTCAGGGGCTCTGAGTCAGG - Intergenic
1119011118 14:70990184-70990206 CTCGGAATGTGCTGTGATTCTGG + Intronic
1119343854 14:73905002-73905024 CCCTTTATGTGCCATGAGTCTGG + Exonic
1121936903 14:98028141-98028163 CTCTCCCTGTGCTATGAGTTTGG - Intergenic
1122704824 14:103614123-103614145 CTCCTCATGGGCCATGATTCAGG + Intronic
1122724863 14:103743780-103743802 CTCGTCATGTGCTATGAGTCCGG - Intronic
1125195369 15:37040301-37040323 CTGGTTATGTGTTCTGAGTCAGG - Intronic
1138769017 16:59639783-59639805 CTCTTCAAGTGCACTGAGTCTGG + Intergenic
1139983018 16:70874960-70874982 CTGCTCATGGGCTTTGAGTCTGG + Intronic
1145396147 17:22496623-22496645 ATCCTCATGTGAGATGAGTCAGG + Intergenic
925223290 2:2160117-2160139 ATCGTCATGTGCTATGTGAGAGG - Intronic
932876234 2:75455408-75455430 CTCTTCATGTGCTATGGCTGGGG + Intergenic
943194628 2:184729988-184730010 TTGGTCATATACTATGAGTCAGG - Intronic
946354246 2:219175074-219175096 CTCCCCATGTGCTATGATGCTGG - Exonic
948269202 2:236661317-236661339 ATCGGCAAGTGCTATAAGTCAGG + Intergenic
1175155162 20:56966177-56966199 CTAGACATGTGTCATGAGTCTGG + Intergenic
1178246391 21:30957076-30957098 CAAGTCATGTGATATGATTCTGG - Intergenic
1180085653 21:45506920-45506942 CTCAGCATCTGCTATGAGACTGG - Intronic
1183170424 22:36183681-36183703 CTGGGTCTGTGCTATGAGTCAGG - Intergenic
1184628917 22:45760222-45760244 TTCATCATGTGCTTTTAGTCAGG + Intronic
950413644 3:12855640-12855662 CTCCTTATGTGCTATGAGGTGGG + Intronic
961792692 3:129387616-129387638 CTCCTCGTGTGCTATGAGCTGGG + Intergenic
973293852 4:48494438-48494460 CTTGTCTTGTGCTAACAGTCTGG + Intergenic
974846189 4:67353308-67353330 TTAGTCATGTCCTATGAGTAGGG + Intergenic
983484975 4:168322712-168322734 CGTGTCAAGTGCCATGAGTCTGG - Intergenic
997890234 5:137670014-137670036 CTGCCCATGTGCTATGAGTAAGG + Intronic
1000062926 5:157672170-157672192 CTCGCCAGGTTCTAAGAGTCAGG - Intronic
1004156693 6:13175466-13175488 CTCTCCCTGTGCTCTGAGTCAGG + Intronic
1004340600 6:14804566-14804588 CTGGCCATGTGCTATGAGTTTGG - Intergenic
1009438564 6:63647355-63647377 CATGTCATTTGCAATGAGTCTGG + Intronic
1016883758 6:148937754-148937776 TCCGTAATGTGCTATGAGACGGG + Intronic
1023174224 7:37420109-37420131 CTCGTCCTGTGCTTTGACTCAGG - Intronic
1025711064 7:63910391-63910413 CTCATCCTGTGCTGTGAGTGTGG - Intergenic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1033816668 7:145082428-145082450 CTCGTCATGTGGACAGAGTCTGG + Intergenic
1034051444 7:147988461-147988483 CTCATAATGTTATATGAGTCAGG + Intronic
1034204666 7:149304977-149304999 CGAGTCATGTGCTATGTGTTAGG + Intergenic
1057290233 9:93801679-93801701 CTCCTCATTAACTATGAGTCTGG - Intergenic
1187519473 X:20001072-20001094 CTCACCATGTGCTATGGGTTAGG - Intergenic
1193317069 X:80076906-80076928 ATAGTCATGTGCTAGGAGTATGG + Intergenic