ID: 1122727368

View in Genome Browser
Species Human (GRCh38)
Location 14:103766505-103766527
Sequence CTGTTGATTAGGAGCAACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122727368_1122727371 -3 Left 1122727368 14:103766505-103766527 CCGTGGTTGCTCCTAATCAACAG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1122727371 14:103766525-103766547 CAGCCATTTATTATGTCAAAGGG 0: 1
1: 0
2: 1
3: 24
4: 205
1122727368_1122727370 -4 Left 1122727368 14:103766505-103766527 CCGTGGTTGCTCCTAATCAACAG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1122727370 14:103766524-103766546 ACAGCCATTTATTATGTCAAAGG 0: 1
1: 0
2: 4
3: 19
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122727368 Original CRISPR CTGTTGATTAGGAGCAACCA CGG (reversed) Intronic
904218819 1:28947483-28947505 CTTTTTATTAGATGCAACCAGGG + Intronic
904400556 1:30253934-30253956 ATGGTGATGAGGAGCCACCAGGG + Intergenic
905626684 1:39494022-39494044 CCTTTTATAAGGAGCAACCAAGG - Intronic
909341441 1:74536004-74536026 CTGATTACTAGGAGCTACCATGG - Intronic
913681287 1:121188306-121188328 ATGTGGACTAGGAGAAACCAAGG + Intronic
916586887 1:166156930-166156952 CTAGGGATTAGGAGCAGCCAGGG + Intronic
917920726 1:179747444-179747466 CTGTTGAATAGCAGAAACAATGG + Intronic
920840627 1:209550906-209550928 CTATAGATTAGGACCAACTAGGG + Intergenic
922040034 1:221887412-221887434 CTGTTGATTAGCCGCATCTATGG + Intergenic
1062944255 10:1448753-1448775 CTGTTGATTTAGACCAAGCACGG - Intronic
1065327482 10:24561625-24561647 CTGTTGTTTATGAGCCACCGAGG + Intergenic
1069952120 10:72026187-72026209 CTGTTGTTTAAAAGCACCCAGGG + Intergenic
1078497124 11:11829211-11829233 GTGTTGATTATGGGCAACAATGG + Intergenic
1079376700 11:19899356-19899378 CTGGTGATTAGATGTAACCATGG + Intronic
1083173075 11:60934378-60934400 CTGGTGATTAGGAGCCGCCGGGG + Intronic
1088984381 11:114892661-114892683 CTGTGGTTTAGCAGCAACCCTGG - Intergenic
1089518096 11:119046397-119046419 CTGGTGAGTTGGAGCAACCATGG - Exonic
1089692905 11:120197843-120197865 CTGTTGCTCAGGATCCACCAGGG - Intergenic
1090396494 11:126422807-126422829 CTGTGGATTGGGACCATCCAAGG + Intronic
1093960194 12:25264256-25264278 CTATTGATTAGGAGTAGCCTGGG - Intergenic
1096743573 12:53711613-53711635 CTGTGTATCAGAAGCAACCAGGG + Intronic
1101740278 12:107495023-107495045 CTGTTGCTTCTCAGCAACCAGGG + Intronic
1106210691 13:27641720-27641742 CTATTGATGTGGAGCAAACAGGG + Intronic
1106780990 13:33058727-33058749 CTGTTGTTTTGGAACAATCACGG + Intronic
1108614086 13:52114431-52114453 TTGTGAATTAGAAGCAACCAAGG - Intronic
1111398746 13:87703834-87703856 CTGATGTGTAGCAGCAACCAAGG + Intergenic
1112441973 13:99431208-99431230 CTGTTCATTTGGGGCAACCTAGG - Intergenic
1114772975 14:25450082-25450104 GTGTAGATTGTGAGCAACCAGGG - Intergenic
1116525090 14:45894443-45894465 CTGTACATTAGGATCACCCAAGG - Intergenic
1116806416 14:49498258-49498280 CTGTTGTTTAGCAACCACCATGG - Intergenic
1116891132 14:50269641-50269663 CTGTTTATTAGGACCTAGCAGGG + Intronic
1118391305 14:65298114-65298136 CTGTGGAATAGGAGCCACCAAGG - Intergenic
1118577941 14:67263135-67263157 GTGTTTATTAGGAGCAAATAGGG + Intronic
1118628739 14:67683591-67683613 CTTTTGATTAGAGGCAAACAGGG - Intronic
1122722993 14:103732470-103732492 CTGGTGCTCAGGAGCACCCAGGG - Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1124400046 15:29340120-29340142 CTGTCAATTAGATGCAACCATGG + Intronic
1129534361 15:76299885-76299907 ATGTTGATGAGAAGGAACCAGGG - Intronic
1129945240 15:79533969-79533991 CTGTGCATTAGCAGCATCCATGG - Intergenic
1130875312 15:88008680-88008702 GTTCTGATGAGGAGCAACCAGGG + Intronic
1145957629 17:28865513-28865535 CTGTTTATCAGGAGCCAACACGG + Intergenic
1146714712 17:35075703-35075725 GTGTTGATTTGGAGCAGGCAGGG - Intronic
1147836716 17:43338076-43338098 CTGTTGCTTATGAGCAGCCATGG + Intergenic
1148539901 17:48472084-48472106 CTGTTCATTAGGGGCAGGCAGGG + Intergenic
1150514302 17:65791401-65791423 CTGATTATCAGAAGCAACCAGGG - Intronic
1156896413 18:42251736-42251758 TTGTTGAATAGGAGCAATGAGGG + Intergenic
1159061468 18:63519118-63519140 TTGGTGAGTAGGAGCAAGCAAGG + Intergenic
1159531481 18:69661118-69661140 CTGTTGTTTATAAGCATCCAGGG - Intronic
1163120197 19:15212828-15212850 CTCATCACTAGGAGCAACCAAGG + Intergenic
926454582 2:13049856-13049878 CAAATGTTTAGGAGCAACCATGG + Intergenic
926902115 2:17763519-17763541 CAGTGGATTAGGAGGAAGCAGGG - Intronic
927053246 2:19349825-19349847 TGGTTGTTTTGGAGCAACCATGG + Intergenic
928937605 2:36695721-36695743 GTGTTGATTAGGAGTAACTTTGG - Intergenic
929309844 2:40409966-40409988 CTAGTGAATAGGAGCAACCACGG + Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930595676 2:53385376-53385398 CTGTTCAATAGCAGCAACCTAGG - Intergenic
930907398 2:56588517-56588539 CTGTGGAATAAGTGCAACCATGG + Intergenic
931213748 2:60222498-60222520 CTGTTGACTAGGAGTGCCCATGG - Intergenic
931388062 2:61815095-61815117 CAGATGACTAGGAGCAACCTTGG + Intergenic
938591215 2:132737883-132737905 CTGTAGAATAAGAGCAATCATGG - Intronic
938805602 2:134804571-134804593 CTGCTGAATAGGAGCAAAGAAGG + Intergenic
938843299 2:135183305-135183327 CTCTTGATTCTGAGCAGCCATGG - Intronic
939648598 2:144733916-144733938 TTACTGATTATGAGCAACCATGG + Intergenic
942745690 2:179229385-179229407 CTGAGGACTAGGAGCAACAATGG - Intronic
1170019193 20:11816982-11817004 CTGTTGTGTAGGAACGACCAGGG + Intergenic
1173869151 20:46330827-46330849 GTGTGGATTAGGAGCCATCACGG - Intergenic
1174984229 20:55431929-55431951 CTCATGATTAGGACCAACTATGG - Intergenic
1175596516 20:60239065-60239087 CTGTTGGTTATGAGCCACCCAGG + Intergenic
1184540569 22:45121279-45121301 CTGTTGATGAGAAGAATCCATGG - Intergenic
956000727 3:64727429-64727451 CAGCTGATTGGGAGCCACCAGGG + Intergenic
960797860 3:121507336-121507358 CTGTTGATTAGAATTTACCATGG + Intronic
961101326 3:124201696-124201718 CATTAGATTAGGAGCACCCAGGG - Intronic
967771623 3:193340119-193340141 CAGTTGATTATGAGCAATGATGG - Intronic
969421890 4:7102329-7102351 CTGTTTCTGGGGAGCAACCAGGG + Intergenic
971311936 4:25532412-25532434 CTGCTGATTTGAAGCAATCAAGG + Intergenic
973238253 4:47929472-47929494 CTGACGATTAGGAGAAAGCAAGG + Intronic
973240495 4:47951155-47951177 CTGTTGTTTCGGAGCAAGCTCGG - Intronic
973644367 4:52935399-52935421 GTGTTGATCAGGAGCCAACATGG - Intronic
974712312 4:65614665-65614687 CTGTTTATTAGGAGAAAACCTGG + Intronic
975743093 4:77449684-77449706 CCTTTGACTAGGAGAAACCAGGG - Intergenic
977324260 4:95554750-95554772 CTGTTGGAGAGGAGCAACAAGGG + Intergenic
977968058 4:103178495-103178517 CTCTTGAATTGGAGCAAACATGG - Intronic
987369523 5:17180426-17180448 GTGGTTATTAGGAGCTACCACGG + Intronic
991350738 5:65718230-65718252 CTGTGCATTAGCAGCATCCATGG + Intronic
997588526 5:135058935-135058957 CTGTTGAATGGGAGCATGCAAGG + Intronic
1000682630 5:164204883-164204905 ATGTTAATTAGGAGTAATCAAGG + Intergenic
1002057699 5:176608265-176608287 CTGTTGCTTGGGAGGAACCTTGG - Intronic
1010351305 6:74878280-74878302 CTGTTAATTAGGAGCCTACAAGG - Intergenic
1011698941 6:89937502-89937524 ATGTTGATTATGAGCATCTATGG - Intronic
1014660929 6:124170757-124170779 ATGTTTATTAGGAACATCCACGG - Intronic
1016594831 6:145787560-145787582 GTGTTGATTTGGAGCAACTGTGG - Intergenic
1017111679 6:150938688-150938710 CTGTTGTTTAGGAGGAGCCGCGG + Exonic
1018800375 6:167217671-167217693 CTGGTGAGTTGAAGCAACCAAGG - Intergenic
1018809780 6:167289674-167289696 CTGGTGAGTTGAAGCAACCAAGG + Intronic
1022380084 7:29851449-29851471 CTGGTGAGGAGGAGCAGCCAGGG - Intronic
1026035225 7:66825613-66825635 CTGTGGACTAGGAGTGACCATGG + Intergenic
1026528019 7:71172640-71172662 CTGTGGAGTGGGAGCTACCAGGG + Intronic
1026984309 7:74545472-74545494 CTGTGGACTAGGAGTGACCATGG - Intronic
1028032929 7:85940628-85940650 CTTTTGATTAATAGCATCCATGG - Intergenic
1029943022 7:104500277-104500299 CAGTTGATTAGAAGGAATCACGG - Intronic
1031736656 7:125371864-125371886 CTCTTGATTAAAAGCAACAACGG - Intergenic
1033991460 7:147292586-147292608 CTGATGATTTGGAGGAATCAGGG + Intronic
1034149750 7:148905613-148905635 CTGGTGCTCAGGAGCAACCTAGG - Intergenic
1034549829 7:151813399-151813421 CTGGTGATTAGGAGTGACCTGGG - Intronic
1046510303 8:115193940-115193962 CTGTTGCTCAGAAGCAAGCATGG + Intergenic
1047896205 8:129369138-129369160 CTGTTGATTATAAGCCACCCAGG + Intergenic
1059194952 9:112362260-112362282 TTGTTGCTCAGGTGCAACCATGG - Intergenic
1061395768 9:130342615-130342637 CTTTTGATTAGGGGCAATCCAGG + Intronic
1187430080 X:19214580-19214602 CTGATGACTAAGAGCAAGCAGGG - Intergenic
1190623566 X:52313644-52313666 CTGTTGATCAGCAGGAAACATGG - Intergenic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1201724325 Y:17136579-17136601 CACTTGATTAGGATGAACCAGGG + Intergenic