ID: 1122727370

View in Genome Browser
Species Human (GRCh38)
Location 14:103766524-103766546
Sequence ACAGCCATTTATTATGTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122727366_1122727370 15 Left 1122727366 14:103766486-103766508 CCTGGCTGCAGCTTGGTATCCGT 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1122727370 14:103766524-103766546 ACAGCCATTTATTATGTCAAAGG 0: 1
1: 0
2: 4
3: 19
4: 195
1122727363_1122727370 23 Left 1122727363 14:103766478-103766500 CCTCACCACCTGGCTGCAGCTTG 0: 1
1: 0
2: 6
3: 56
4: 408
Right 1122727370 14:103766524-103766546 ACAGCCATTTATTATGTCAAAGG 0: 1
1: 0
2: 4
3: 19
4: 195
1122727362_1122727370 24 Left 1122727362 14:103766477-103766499 CCCTCACCACCTGGCTGCAGCTT 0: 1
1: 0
2: 4
3: 44
4: 356
Right 1122727370 14:103766524-103766546 ACAGCCATTTATTATGTCAAAGG 0: 1
1: 0
2: 4
3: 19
4: 195
1122727368_1122727370 -4 Left 1122727368 14:103766505-103766527 CCGTGGTTGCTCCTAATCAACAG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1122727370 14:103766524-103766546 ACAGCCATTTATTATGTCAAAGG 0: 1
1: 0
2: 4
3: 19
4: 195
1122727365_1122727370 18 Left 1122727365 14:103766483-103766505 CCACCTGGCTGCAGCTTGGTATC 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1122727370 14:103766524-103766546 ACAGCCATTTATTATGTCAAAGG 0: 1
1: 0
2: 4
3: 19
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122727370 Original CRISPR ACAGCCATTTATTATGTCAA AGG Intronic
903697408 1:25218072-25218094 TCAGCCATTGCTTATTTCAAGGG - Intergenic
911274536 1:95844996-95845018 ATTGCATTTTATTATGTCAAAGG - Intergenic
912481773 1:109987181-109987203 AAAGACATTTATTAAGTTAATGG + Intronic
912544723 1:110442386-110442408 ACAGACATTTATTTTTTCATAGG + Intergenic
917525764 1:175787148-175787170 AAAGCCCTTGAATATGTCAATGG + Intergenic
918963779 1:191313467-191313489 ACAGTCATTTAATATATCATGGG + Intergenic
920222419 1:204413401-204413423 CCAGCCATTTTTTTTTTCAAAGG - Intergenic
921515913 1:216092170-216092192 TCAGCCAGGTAATATGTCAATGG + Intronic
921854466 1:219966657-219966679 ACAGCTATTTATTATGTGCTGGG + Intergenic
923969079 1:239179290-239179312 ACCCCAATTTATTATGCCAAGGG - Intergenic
924461819 1:244266352-244266374 ACAACAATTGATTATCTCAAGGG - Intergenic
1064607483 10:17058702-17058724 GGAGCCATTTATATTGTCAAGGG - Intronic
1066363453 10:34753452-34753474 ACAGCCATTTAACATGGCAAAGG + Intronic
1067911047 10:50347321-50347343 ACAGCCATTTTCATTGTCAATGG - Intronic
1070274073 10:74987621-74987643 ACAGCCATCTATTATGTGCTTGG - Intronic
1071788775 10:88932611-88932633 CCAGCCCTTTATTAAGTCACTGG + Intronic
1072048172 10:91678070-91678092 ACAGTCATTTATTAAGCCCAGGG + Intergenic
1074173230 10:110966770-110966792 ACAGCCATTGAATTTGTTAATGG + Intronic
1079916735 11:26377923-26377945 ACAGCCATCTTTAATGTGAAAGG + Intronic
1080904312 11:36525187-36525209 ACAGCCAATTTTTTTGACAATGG - Intronic
1082726238 11:56740344-56740366 ACACCCATGTATTTTGTCATTGG + Intergenic
1085779019 11:79391850-79391872 ACATGCATTTATTATTTCTATGG + Intronic
1085895726 11:80637264-80637286 ACAGCCCTTTAAAATGTCAAAGG - Intergenic
1085983548 11:81755616-81755638 ACAGCCAAGTATTATGTCTTGGG - Intergenic
1087702010 11:101445464-101445486 AAAGGCATTTAATATGTCACAGG - Intergenic
1089037373 11:115408695-115408717 ACATCCATTTCTTATGTGAAAGG + Intronic
1091058002 11:132436864-132436886 CCAGCCATTTGCTATGTAAATGG + Intronic
1092957832 12:13565935-13565957 AGAGGCATTGATCATGTCAAAGG + Intronic
1093993206 12:25613161-25613183 ACAGACATTTATTCTCTTAAAGG - Intronic
1094017275 12:25878694-25878716 TCAGCCATTGGTTTTGTCAATGG + Intergenic
1096746760 12:53733737-53733759 ACAGCTATTTATTTTGTGACAGG - Intergenic
1099425562 12:82518824-82518846 TCAACCAATTATTATGGCAAAGG + Intergenic
1101818319 12:108162829-108162851 ACAGCCATTTACCAAGTCCAGGG - Intronic
1101827938 12:108235295-108235317 ACAGTCATTTACTTAGTCAAAGG + Intronic
1102609695 12:114100657-114100679 AAAGTCATTTATTAGGTAAATGG + Intergenic
1102637906 12:114340663-114340685 ACAACCATTTATTATGCCTTTGG + Intergenic
1106633433 13:31501592-31501614 ACAGAAATTTATTTTCTCAAAGG - Intergenic
1106765470 13:32909141-32909163 ACAGTGATTTATTATCTCTAAGG + Intergenic
1108104032 13:46989257-46989279 ACAGAAATTTATTATCTCATGGG - Intergenic
1108520653 13:51244179-51244201 ACAGCAGTTTATTCCGTCAATGG + Intronic
1111221535 13:85210528-85210550 ACAGACATGTATTATGTGAGAGG - Intergenic
1111496290 13:89055022-89055044 ACAGCCATTTATTAAAACAATGG - Intergenic
1114462627 14:22897183-22897205 ACAGACATTTAATATGTGCAAGG + Intergenic
1114522356 14:23347422-23347444 ACAGCCATTTCTTCTGGCACAGG - Intronic
1116295230 14:43099308-43099330 ACAGCCATTTATTATGGATTTGG + Intergenic
1117372355 14:55090136-55090158 ACAGGCGTTTATTCTATCAAAGG - Intergenic
1117698839 14:58393795-58393817 ACAGGCATTAACTATGTGAAAGG + Intergenic
1118396164 14:65338596-65338618 AAAGAGATTTATTAGGTCAAAGG + Intergenic
1120600385 14:86497616-86497638 AGTGGCCTTTATTATGTCAAGGG + Intergenic
1121420112 14:93807207-93807229 ACAGCCATTTGTTATGCTCATGG - Intergenic
1122007926 14:98720949-98720971 ACAGCCACCTATTAGGTCCAGGG + Intergenic
1122727370 14:103766524-103766546 ACAGCCATTTATTATGTCAAAGG + Intronic
1125274858 15:37979137-37979159 ACAGATCTTAATTATGTCAAAGG + Intergenic
1125732229 15:41899526-41899548 ACAGGCATTTATTATGTCTAGGG - Exonic
1126426713 15:48535256-48535278 ACAGGCATGTATTAGGTCAGTGG - Intronic
1126676845 15:51166950-51166972 ACAGCCATTTATTATGCTTGTGG - Intergenic
1127214386 15:56809403-56809425 ACAGCCATTTATTAGGCTCATGG + Intronic
1130002243 15:80057838-80057860 ACAGCCATTCAATATGTCCAAGG - Intergenic
1130694844 15:86120776-86120798 AAACACATTTATTATGCCAAAGG - Intergenic
1131780834 15:95857013-95857035 ACATCTATTTTATATGTCAAAGG + Intergenic
1133656361 16:7868346-7868368 ACACTCATTTATTATCTCACAGG - Intergenic
1133912985 16:10082709-10082731 ACACCCATTTATTATCTCATGGG - Intronic
1137893705 16:52188328-52188350 ACAGCAATTTAGCATGTCAGAGG + Intergenic
1139005413 16:62564717-62564739 AAAGACATTGATTATTTCAATGG + Intergenic
1139050484 16:63119449-63119471 ACAAGCCTTTATTATGTAAATGG + Intergenic
1139171300 16:64632993-64633015 TCAGCCATTTGTGATTTCAAAGG + Intergenic
1140066277 16:71614220-71614242 ACAACCATTTATTATGCTCATGG + Intergenic
1140451024 16:75070973-75070995 ACAACTATTTATTATGCCCATGG + Intronic
1141857306 16:86692320-86692342 ACAGCCATTGATTATGACTGAGG - Intergenic
1143751150 17:9028844-9028866 AGAGCCATTTATTTTGGTAAAGG - Intronic
1144224485 17:13131686-13131708 ACACCCATTTATTATTTCACAGG - Intergenic
1148972963 17:51500351-51500373 CAAGCCTTTTATTATGTAAAAGG - Intergenic
1149251163 17:54771110-54771132 AGAGCCATTTATCTTATCAAGGG + Intergenic
1149792473 17:59491351-59491373 ACAGACATTTATTTGGTCATGGG + Intergenic
1151733546 17:75925030-75925052 ACAGCCTTTTATGATTTCAGGGG + Intronic
1154973680 18:21436211-21436233 ACAGCCATTTAATTTATCATAGG + Intronic
1155525487 18:26712395-26712417 ACAGCCATTTCTTAGGTTTAAGG + Intergenic
1155541600 18:26873926-26873948 ACAGACATTTATTTTCTCACAGG + Intergenic
1158078237 18:53557120-53557142 ACAGCAATTTTTTATGTTAATGG + Intergenic
1158809894 18:61020365-61020387 ACAGCCACTCAATAAGTCAACGG + Intergenic
1158824622 18:61202386-61202408 ACAGCCATTTATTAAATTAGAGG + Intergenic
1159197031 18:65130097-65130119 ACAGACATTTTTTATGTTACTGG + Intergenic
1159243191 18:65770173-65770195 ACATCAATTTAAGATGTCAAAGG + Intronic
1161863060 19:6813083-6813105 ACAACCATTTATTATGCTTATGG + Intronic
1162638907 19:11991700-11991722 ACAGGCTTTTATAATGTGAAAGG + Intergenic
925448047 2:3944472-3944494 ATTGCCAATTATCATGTCAAAGG + Intergenic
928789234 2:34931551-34931573 AAAGCCGTTTGTCATGTCAAGGG + Intergenic
929322854 2:40566368-40566390 ACAGCCAGTTAGTAAGTCAGTGG + Intronic
931841847 2:66159587-66159609 TTATCCATTTACTATGTCAATGG - Intergenic
932290538 2:70573834-70573856 ACAGTCATTTATTATCTCTCAGG - Intergenic
932544291 2:72691326-72691348 ACAGAAATTTATTATCTCACAGG - Intronic
932722019 2:74145424-74145446 ACAGCCATGGGTTATGTCAGAGG + Intronic
932802613 2:74755055-74755077 TGAACCATTAATTATGTCAAAGG + Intergenic
932936617 2:76110501-76110523 ACACACATTTATTATCTCACAGG + Intergenic
933306966 2:80613085-80613107 ACTGCCATTTACTCTGTAAAAGG - Intronic
935809057 2:106778137-106778159 ACAGCAATTTATTTTCTCACAGG - Intergenic
941051944 2:160744991-160745013 ACAGCCATGTGTTAAGTCAGAGG + Intergenic
941169069 2:162115935-162115957 ACAACCTTTTATTATGTTCATGG + Intergenic
941907225 2:170728573-170728595 ACATACATTTATTATCTCACGGG + Intergenic
942623076 2:177869202-177869224 ACACCTATTTATTATCTCAGAGG + Intronic
944572308 2:201056883-201056905 ACAGCCTTTCACAATGTCAAGGG - Intronic
1169774085 20:9233030-9233052 ACAGTGATTTATATTGTCAAAGG + Intronic
1173745337 20:45432400-45432422 AGAGCCATTTCTTATGGAAAAGG + Intergenic
1175307797 20:57989234-57989256 ACAGGCATTCAATATATCAAGGG - Intergenic
1175479073 20:59299182-59299204 ACAACCATTTATTATGCTCATGG + Intergenic
1175974755 20:62705060-62705082 ACAGGCATTTATTATGTCAGTGG - Intergenic
1177532995 21:22387543-22387565 ACATACAATTTTTATGTCAATGG - Intergenic
1178239989 21:30888214-30888236 ACAGCCATTTATGATGTCCATGG + Intergenic
1183007472 22:34915372-34915394 ACAGCCTTGGAGTATGTCAATGG - Intergenic
1183034221 22:35128990-35129012 ACAGTCATGTATTATGTAGATGG + Intergenic
949170134 3:987355-987377 AAAGGCATTTACTAAGTCAATGG + Intergenic
949322121 3:2823262-2823284 TCAGCCTTTTATTATATCAGTGG + Intronic
950903229 3:16515134-16515156 ACACCCATTTATGAAGCCAAAGG + Intergenic
952292439 3:32030799-32030821 ACAGCAATTCCTTATCTCAAGGG + Intronic
952739171 3:36719044-36719066 ATAGGGATTTATTATGTAAAGGG - Intronic
953108691 3:39911140-39911162 AAAGCCATGTGTTATTTCAAAGG - Intronic
953758152 3:45665667-45665689 AAAGCCTTTTATTTTGTCAACGG + Exonic
957009840 3:74991140-74991162 ACAGACATTTTTTCTGTCATAGG - Intergenic
957019967 3:75115137-75115159 ACAACCATATTTTATGTCTATGG + Intergenic
957803334 3:85114852-85114874 ATAACCATTTATTATGTTAAAGG + Intronic
958454632 3:94315393-94315415 ACAACCATTTATTATGTTTATGG + Intergenic
958551079 3:95613799-95613821 ACAGTCATTATTTATGACAAAGG - Intergenic
960457561 3:117891727-117891749 ACAGCCATTTTGTCTGGCAATGG + Intergenic
961572626 3:127810985-127811007 ACAGCCATCCAGTATCTCAAGGG + Intronic
962845039 3:139266712-139266734 ACAGGCAGTTATTATGACACTGG + Intronic
965665864 3:171092721-171092743 ACTGCTAATTATTATTTCAAAGG + Intronic
966313788 3:178623826-178623848 ACAGCTATTCATGATGTCAGGGG + Intronic
967749094 3:193093569-193093591 ACAGTCAATTATTATGACCAAGG + Intergenic
968779117 4:2565926-2565948 ACAGCCACTTATTACAGCAAAGG - Intronic
970787469 4:19816337-19816359 ACACACATTTATTATCTCACAGG - Intergenic
970805756 4:20029652-20029674 ACTGTCATTTATTATGTTAGAGG - Intergenic
971493454 4:27238860-27238882 ACAAACATTTATTATCTCACAGG + Intergenic
972994405 4:44862762-44862784 AAAGGCTTTTATTATTTCAAAGG + Intergenic
972994522 4:44863950-44863972 ACAGCTATTTATCACGTAAATGG - Intergenic
974757204 4:66225401-66225423 ACAGATATTTATTATCTCATAGG + Intergenic
977082594 4:92551290-92551312 ACACGCATTTCTTATGTCACAGG + Intronic
977263449 4:94825643-94825665 TCACCCATGTATTTTGTCAATGG - Intronic
977901153 4:102423848-102423870 ACAATCATTTATTATGCCTAAGG - Intronic
979888963 4:126065548-126065570 ACAGGCTTTTATTATGCCAGTGG - Intergenic
980161246 4:129165884-129165906 AGACCCATTTATTGTTTCAATGG - Intergenic
980340943 4:131546824-131546846 ACAGCCATTTAGTGTTTAAAAGG + Intergenic
981536115 4:145801644-145801666 ACAATCATTAATTATGCCAAAGG - Intronic
983563062 4:169120715-169120737 ACAGGCAATTATAATGTGAAAGG + Intronic
985295057 4:188427963-188427985 ACACCTATTTATTATCTCATAGG - Intergenic
985869546 5:2543196-2543218 ATACCCATTATTTATGTCAAGGG + Intergenic
985915130 5:2912237-2912259 ACATGCATTTATAATTTCAATGG + Intergenic
987449592 5:18065156-18065178 ACACCCATTTGTTATCTCACTGG - Intergenic
988480405 5:31625510-31625532 ACTGCCAATTATTAGATCAAGGG - Intergenic
989560002 5:42839470-42839492 ACAGCAATTTATTTTCTCACAGG - Intronic
991982945 5:72252192-72252214 ACAGCTTTTGATTATCTCAAGGG + Intronic
992277814 5:75139337-75139359 ACAGCCATTCTGTATCTCAATGG + Intronic
992366050 5:76090896-76090918 ACAGCCATGTATTTTGGCAGTGG + Intronic
995147172 5:108799688-108799710 AAAGCCTTCTATTATGTTAATGG + Intronic
995402602 5:111758876-111758898 ACAGGCATTTGTTGTGGCAATGG - Intronic
995448795 5:112277434-112277456 ACAGCCATTTTATATGTGAATGG - Intronic
996024673 5:118631638-118631660 ACATACATTTATTATGTAAAAGG - Intergenic
999544552 5:152612951-152612973 AAACCCATTTATTATGTTCATGG + Intergenic
1000599476 5:163254504-163254526 AGAGCCATTTCTCATGTGAATGG - Intergenic
1000930043 5:167240591-167240613 CCAGCCATCTATAATGTCACTGG + Intergenic
1005211096 6:23464671-23464693 ACAGAAATGTATTGTGTCAATGG + Intergenic
1006692520 6:35901497-35901519 ACAGAAATTTATTATCTCACAGG - Intronic
1006869362 6:37236726-37236748 ATAACCATTTATTATGTGAATGG + Intronic
1009283660 6:61783865-61783887 ACAGCATTTAATTATGTGAATGG + Intronic
1009806395 6:68606188-68606210 AAAGGCATTTGTTAAGTCAATGG - Intergenic
1013775825 6:113677293-113677315 ATAAACATTTATTATTTCAATGG - Intergenic
1014051836 6:116963928-116963950 ACATCCATTTATTATCTCATAGG + Intergenic
1014821548 6:125994059-125994081 ACAGCCCTTTTTTAGGTGAAAGG - Intronic
1015002945 6:128242034-128242056 CCAGACATTTATTATGACAGAGG + Intronic
1016240499 6:141923665-141923687 ATAACAATTTATTATGTCAAGGG - Intergenic
1016556864 6:145348407-145348429 ACAGCCATTTACCATGTCAATGG + Intergenic
1017827999 6:158096671-158096693 ACAGCCATTTAAAAATTCAATGG - Exonic
1018357230 6:163030493-163030515 AGAGCCAGTTGTTATGTCACAGG + Intronic
1018570731 6:165206892-165206914 ACTGCCATTTCTTATGGCACAGG - Intergenic
1018946666 6:168352058-168352080 ACAGCCCTTTATCAGGTCTATGG - Intergenic
1020705172 7:11535033-11535055 ATAGCCATTTACTTTGTCATAGG - Intronic
1021008396 7:15429544-15429566 ACAGAAATTTATTATCTCACTGG - Intronic
1022796278 7:33734078-33734100 ACAGCCATTTGTTATGTTCCAGG + Intergenic
1024480931 7:49862000-49862022 ACAACCATTTTTTATGGAAATGG - Intronic
1026268601 7:68817133-68817155 ACAGCCATTTATTGTGACCTTGG - Intergenic
1029012305 7:97274519-97274541 ACAGTCATTTATTGTTTTAATGG + Intergenic
1030656381 7:112173037-112173059 ACAGACATTTATAATTTCACTGG + Intronic
1030854342 7:114534073-114534095 ACTGCACTTTATTTTGTCAAAGG + Intronic
1031806085 7:126307640-126307662 ACTGCCATTCTTTGTGTCAAGGG - Intergenic
1033011506 7:137627264-137627286 GCAGCTATTTATAATGGCAAGGG - Intronic
1035379519 7:158428838-158428860 ACAGCTATTTTTCATGGCAATGG + Intronic
1035632495 8:1119271-1119293 ACAAGCTTATATTATGTCAAAGG - Intergenic
1036588263 8:10145018-10145040 ACAGCTATTTATTGTCTGAAAGG - Intronic
1037258839 8:16984631-16984653 ACATACATTTATTAACTCAAGGG - Intergenic
1038937493 8:32268303-32268325 ACACACATTTATTATCTCACGGG - Intronic
1039178480 8:34836489-34836511 ACAGCAATTTATTTGGTCACAGG + Intergenic
1040386383 8:46917637-46917659 AGAGCCATTTATTAAGACAGGGG - Intergenic
1041210578 8:55546765-55546787 AAGGGCATTTATTATGTGAATGG - Intergenic
1043711821 8:83429412-83429434 ACATTCATTTATTCTTTCAAAGG - Intergenic
1044528971 8:93286584-93286606 ACAGCCATCTATGAAGTAAAGGG - Intergenic
1045202891 8:100004196-100004218 AAAGCCATTTAATAATTCAATGG + Intronic
1046478318 8:114779287-114779309 ACAGCCATTTATGAATGCAAAGG + Intergenic
1046758573 8:117996601-117996623 ACAGCCATTTATTAAGTTGATGG - Intronic
1051961415 9:22768594-22768616 ACAATGATGTATTATGTCAAAGG - Intergenic
1052604983 9:30687912-30687934 ACAGACATAAATTATGTCAATGG + Intergenic
1054806470 9:69400714-69400736 ACAAACATTTATTATGTCACAGG + Intergenic
1054900382 9:70362935-70362957 ACAGACATTTCTTGTGTGAACGG - Intergenic
1058596067 9:106617067-106617089 ACAGTCATTTAGAATTTCAAAGG - Intergenic
1185751442 X:2612980-2613002 CCAGCCACTTATTATGAAAATGG + Intergenic
1185879842 X:3731318-3731340 ACAGCTATTAATTAAGACAATGG + Intergenic
1187516230 X:19973879-19973901 ATAGCCATTTGATATGCCAAAGG + Intergenic
1190407858 X:50105421-50105443 ACAGCCTTTTAGGAAGTCAAAGG - Intergenic
1193012832 X:76696930-76696952 ATAGCCAAGTACTATGTCAAGGG + Intergenic
1193319645 X:80106473-80106495 CCAGCCATTTACTTTGTCTAAGG + Intergenic
1193677376 X:84472328-84472350 ATAGCTATTTCTTATGTAAATGG - Intronic
1193758140 X:85434035-85434057 ACACCCATTTATTAGCTCACAGG + Intergenic
1193984840 X:88228064-88228086 ATACCCAGGTATTATGTCAAGGG + Intergenic
1195230646 X:102843530-102843552 ATAGCCATTTATTATCTCTCAGG - Intergenic
1195345895 X:103951000-103951022 ACAGACATTTATTGTCTCACAGG + Intronic
1195361708 X:104088514-104088536 ACAGACATTTATTGTCTCACAGG - Intergenic
1197406741 X:126063164-126063186 AAAGCCATTCAGTAGGTCAATGG + Intergenic
1199031610 X:143006697-143006719 ACAGTCATTTAGAATGCCAAGGG + Intergenic
1199095164 X:143729516-143729538 AAAGTCATTTATTAGGTCTAGGG + Intergenic
1199287869 X:146073939-146073961 GCACCCATTTATGATGTCACAGG - Intergenic
1201484875 Y:14482860-14482882 ACATCCATGTATGATTTCAATGG - Intergenic