ID: 1122728319

View in Genome Browser
Species Human (GRCh38)
Location 14:103775775-103775797
Sequence CTTCCAGGCGGATCTGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122728319_1122728323 7 Left 1122728319 14:103775775-103775797 CCTGAAGCAGATCCGCCTGGAAG 0: 1
1: 0
2: 2
3: 10
4: 121
Right 1122728323 14:103775805-103775827 TAGAGGCTCTTGATTTGCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 152
1122728319_1122728321 -10 Left 1122728319 14:103775775-103775797 CCTGAAGCAGATCCGCCTGGAAG 0: 1
1: 0
2: 2
3: 10
4: 121
Right 1122728321 14:103775788-103775810 CGCCTGGAAGAACTCTGTAGAGG 0: 1
1: 0
2: 0
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122728319 Original CRISPR CTTCCAGGCGGATCTGCTTC AGG (reversed) Intronic