ID: 1122728319

View in Genome Browser
Species Human (GRCh38)
Location 14:103775775-103775797
Sequence CTTCCAGGCGGATCTGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122728319_1122728323 7 Left 1122728319 14:103775775-103775797 CCTGAAGCAGATCCGCCTGGAAG 0: 1
1: 0
2: 2
3: 10
4: 121
Right 1122728323 14:103775805-103775827 TAGAGGCTCTTGATTTGCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 152
1122728319_1122728321 -10 Left 1122728319 14:103775775-103775797 CCTGAAGCAGATCCGCCTGGAAG 0: 1
1: 0
2: 2
3: 10
4: 121
Right 1122728321 14:103775788-103775810 CGCCTGGAAGAACTCTGTAGAGG 0: 1
1: 0
2: 0
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122728319 Original CRISPR CTTCCAGGCGGATCTGCTTC AGG (reversed) Intronic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
901827616 1:11872650-11872672 TGTCCAGGCCGAGCTGCTTCTGG + Intergenic
904710582 1:32426957-32426979 CGTCCAGGCGGCTCAGCCTCTGG - Intergenic
905648474 1:39640459-39640481 CTTCCTGGGGCCTCTGCTTCTGG + Intergenic
908766062 1:67555566-67555588 CTTCCAGCTGCCTCTGCTTCCGG - Intergenic
911727891 1:101261604-101261626 TGTCCAGGCAAATCTGCTTCTGG + Intergenic
916175038 1:162031041-162031063 CTTCCAGGAGTATCTGCATGTGG - Intergenic
920136599 1:203774376-203774398 CTTCCACTGGGATCTGCTGCTGG - Exonic
924385314 1:243493954-243493976 CTGCAAGGCGGAGCTGCTGCAGG + Intronic
1062789222 10:290885-290907 CTGCCAGGTGCATCTGATTCCGG - Intronic
1062864925 10:844161-844183 CTTCCAGGTGTAGCTGATTCTGG + Intronic
1064487396 10:15808571-15808593 CTTCCAGTGGGATCTGTTACTGG - Intronic
1069597348 10:69681090-69681112 CTTCCAGGCTGGTCTCCTTGAGG - Intergenic
1074914157 10:117939506-117939528 CTTCCAGGAGTAGCTCCTTCTGG + Intergenic
1077367688 11:2167727-2167749 CTGCCAGGCAGCTCTGCTCCAGG - Intronic
1078004691 11:7523757-7523779 TTCCCAGGTGGCTCTGCTTCAGG + Intronic
1078460597 11:11512335-11512357 CCTCCTGGCGGATCTGGGTCAGG - Intronic
1083091829 11:60207835-60207857 CTGCCAGGAGCATCTGCTGCAGG + Intronic
1083430781 11:62612752-62612774 CTTCCTGGCGGCTCCGCGTCCGG - Exonic
1084757924 11:71251282-71251304 CCTCCAGGCGGGTCTGCGTGCGG - Intronic
1085300819 11:75457231-75457253 CTTCCAGGAGCCTCTGCTTCAGG - Intronic
1085530798 11:77190881-77190903 CTTCCGGGAGGAGGTGCTTCCGG - Intronic
1085534952 11:77212128-77212150 CTGCCAGGCTGAGCTTCTTCTGG - Intronic
1088906337 11:114157958-114157980 CTTCCAGGCATTTCTGCGTCCGG + Intronic
1091699291 12:2649472-2649494 CTTCCTGGGGACTCTGCTTCTGG + Intronic
1093520226 12:20041493-20041515 CTTCCAAGTGAATCTGATTCTGG + Intergenic
1101709403 12:107250799-107250821 CTTCCAGGAGCACCAGCTTCTGG + Intergenic
1101822036 12:108191719-108191741 CTTCCAGGGGGCTCTTCCTCTGG + Intronic
1101991350 12:109487899-109487921 CTTCCAGGTGGACCTGCTATAGG + Intronic
1104466336 12:128993870-128993892 CTCCCAGGAGGATCTGCTGGGGG - Intergenic
1106701841 13:32237621-32237643 CTTCAAGGAGGATGAGCTTCTGG - Exonic
1106760019 13:32859019-32859041 CTTCCTGCAGGATCTGCTGCAGG - Intergenic
1107018635 13:35729719-35729741 ATTCCAGGTGGTTCTGCTTGTGG + Intergenic
1108277537 13:48826318-48826340 TGTCCAGGCAGATCTGCTGCAGG - Intergenic
1112435920 13:99391079-99391101 GTTCTAGGCTGATCAGCTTCCGG - Intergenic
1117035590 14:51725049-51725071 CTCCCAGGGGGATCTGCTGCAGG + Intronic
1117566146 14:56995539-56995561 CTTCAGGGCGAATCTGCTTCTGG - Intergenic
1121553747 14:94820863-94820885 CTTCCAGGAGGGTCAGCCTCAGG + Intergenic
1121989892 14:98546458-98546480 CTTCCAGGCAGTTCTGTTCCAGG - Intergenic
1122481415 14:102049803-102049825 CTTCCAGGCAGAGCTCCTCCAGG - Exonic
1122728319 14:103775775-103775797 CTTCCAGGCGGATCTGCTTCAGG - Intronic
1124140537 15:27073251-27073273 CTTCCAGGCAGACATGCTGCAGG - Intronic
1125549232 15:40532456-40532478 CTTCAAAGAGAATCTGCTTCTGG + Intronic
1129869474 15:78931491-78931513 CTTCCAGGCGGAACAGCAGCTGG - Exonic
1131870200 15:96756315-96756337 CTTTCAGGAGCTTCTGCTTCGGG + Intergenic
1132678245 16:1129510-1129532 CTTCCGGGAGGATCTGCTTCCGG + Intergenic
1132678249 16:1129526-1129548 CTTCCGGGAGGATCTGCTTCCGG + Intergenic
1132945683 16:2530424-2530446 CTTCGAGGCGGGTGGGCTTCTGG + Exonic
1133046414 16:3090705-3090727 CTTCCAGGCCAATCAGGTTCTGG - Intronic
1134459505 16:14419266-14419288 CTTCCATGGGGATCTGATTAAGG - Intergenic
1135895435 16:26396945-26396967 CTTCCAAGCAGTCCTGCTTCTGG - Intergenic
1135978134 16:27124617-27124639 CACCCAGGAGGATCCGCTTCTGG - Intergenic
1139908779 16:70383750-70383772 CTTCCAGACTGCTCTGCTTCTGG + Intronic
1141766839 16:86064433-86064455 CTTCCAGGTGGGACTGCCTCTGG - Intergenic
1147959220 17:44155938-44155960 CTTCCAGGCAGATCCACTCCAGG + Intronic
1148835176 17:50462243-50462265 CTTCTGGACAGATCTGCTTCAGG - Exonic
1149396321 17:56248785-56248807 CTTCCCCTAGGATCTGCTTCTGG - Intronic
1149541240 17:57469778-57469800 CTTCCAGATGGTTCTGCTTTTGG + Intronic
1151830419 17:76546062-76546084 CTCCCAGCTGGCTCTGCTTCCGG + Intronic
1152154226 17:78622505-78622527 ATTCCACCTGGATCTGCTTCGGG - Intergenic
1152905232 17:82966537-82966559 CAGCCAGGCGGCTCTGCTTCTGG - Intronic
1153757893 18:8302067-8302089 CTTCCAGGACCATCAGCTTCAGG - Intronic
1159145506 18:64449002-64449024 GTTCCAGCAGAATCTGCTTCAGG - Intergenic
1159996915 18:74973762-74973784 GTTCCAGGCGTCTCTGCTCCTGG + Intronic
1161019384 19:2000875-2000897 CTTCAAGGCGCATCTGCACCGGG - Intronic
1161313447 19:3607200-3607222 GGTCCAGGCGGATCGGCTCCCGG + Intergenic
1165069405 19:33247109-33247131 CTCCCAGGCTGACCTGCTTCAGG - Intergenic
1166966403 19:46531743-46531765 CTTCCAGACAGATCTGCTCCAGG - Intronic
927218556 2:20684811-20684833 CATACAGGCAGAGCTGCTTCTGG + Intronic
927523943 2:23720646-23720668 ACTCCAGGCGGATCTGATTTGGG - Intergenic
930551329 2:52838416-52838438 CTTCCAGGAGCATTTGCATCAGG + Intergenic
936500519 2:113062582-113062604 CTGACAGGCTGATCGGCTTCAGG - Exonic
938770476 2:134496928-134496950 CTTCCAGGCGGAGCTGCAGAGGG - Intronic
938792518 2:134689588-134689610 CTTCCAGGGAGGCCTGCTTCAGG + Intronic
940300971 2:152175997-152176019 GTTCCAGGCGGGACTACTTCCGG - Intergenic
944932910 2:204538571-204538593 CTGCCAGGCGGCCCAGCTTCTGG + Intergenic
948106975 2:235422018-235422040 CTTCAAGGTGGATCTGGATCTGG + Intergenic
948652358 2:239456270-239456292 CTCCCAGGCTGTTCTGCTCCAGG + Intergenic
1169106422 20:2999538-2999560 CTTACAAATGGATCTGCTTCTGG - Intronic
1170509497 20:17061891-17061913 CATCTAGGCAGCTCTGCTTCTGG + Intergenic
1175823321 20:61923606-61923628 CCTCCAGGCGGATCAGCTTGTGG - Exonic
1177905129 21:26965572-26965594 CCGCCAGGTGGAGCTGCTTCTGG - Exonic
1178621787 21:34183573-34183595 CTTCCAGGCGACTCTGATGCTGG + Intergenic
1180201656 21:46228457-46228479 CTTCCAGGCCGGTCTGCTCGCGG + Exonic
1183112082 22:35657833-35657855 CTTCAAGGCAGAGCTGCATCAGG - Intronic
1183543247 22:38441811-38441833 CTTCCAGGCGGTGCTGCTGAAGG - Intronic
1183883657 22:40857825-40857847 CTTGCAGGCGGATCTGCCATTGG + Intronic
1184235705 22:43182005-43182027 CTTCCGGGCCTTTCTGCTTCCGG - Intronic
1184235709 22:43182021-43182043 CTTCCGGGCCTTTCTGCTTCCGG - Intronic
1185368350 22:50447108-50447130 CTGCCCGGCTGCTCTGCTTCCGG - Exonic
950218928 3:11179650-11179672 CTTCCAGGGCGATATCCTTCTGG - Intronic
954361466 3:50124895-50124917 CATCCTGGCAGATCTGTTTCAGG - Intergenic
954830399 3:53416627-53416649 CTTCAAAGCAGATCTACTTCTGG + Intergenic
963779895 3:149476413-149476435 CTTCCACCAGGCTCTGCTTCAGG + Intronic
965558367 3:170038979-170039001 CTTCCAGCCGAACCTGCCTCCGG - Exonic
966362713 3:179148097-179148119 CTTCTTTGCGCATCTGCTTCCGG + Intronic
967137533 3:186525032-186525054 CTGCCAAGCTAATCTGCTTCTGG + Intergenic
968458870 4:713693-713715 CATCCATGAGGATCAGCTTCCGG - Intronic
997431336 5:133843224-133843246 CTTCCAGGTGCATCTCATTCAGG + Intergenic
997955468 5:138275367-138275389 CTTCCAAGCCATTCTGCTTCTGG - Intergenic
1003703267 6:8494513-8494535 CTTCCAGGAGGATCTACTTAGGG + Intergenic
1006813665 6:36837012-36837034 CTTCCTGGGGGATGTGGTTCTGG - Intronic
1006823125 6:36914369-36914391 CTTCCAGGAGCATCACCTTCAGG - Exonic
1007227132 6:40322844-40322866 CTTCCAGGTGCAGCTGCTGCTGG + Intergenic
1007787030 6:44286500-44286522 GTTCCGGGAGCATCTGCTTCAGG + Exonic
1008378773 6:50820269-50820291 CTTCGAGGCGGCTCTGCGCCGGG - Intronic
1012043514 6:94239578-94239600 CTTACAGGCCCTTCTGCTTCAGG - Intergenic
1017916937 6:158838329-158838351 CTTCCAAAAGGATCTGTTTCAGG + Intergenic
1019452509 7:1107035-1107057 CTTCCAGGCAGAGCTGATGCTGG - Intronic
1021973386 7:25986690-25986712 CTTCCTGGAGGTTGTGCTTCTGG - Intergenic
1024318771 7:48045085-48045107 CTTCTAGGATGATCTACTTCTGG + Intronic
1027620118 7:80474026-80474048 CTTCCAGGCTAAAATGCTTCTGG - Intronic
1034132220 7:148730155-148730177 GGTCCAGGCCAATCTGCTTCAGG - Exonic
1037174796 8:15933998-15934020 CACCCAGGAGGCTCTGCTTCAGG - Intergenic
1037609169 8:20462036-20462058 CTTCCAGGAGGACGTGCTTTGGG + Intergenic
1037860061 8:22398757-22398779 CTTCTAGGCAGAGCTACTTCTGG + Intronic
1038915058 8:32012084-32012106 ATTACAGGTGGATCAGCTTCGGG + Intronic
1044966678 8:97580599-97580621 CTTCCCTGGGGATCTGCTTCAGG - Intergenic
1047556698 8:125939648-125939670 CCTGCAGCAGGATCTGCTTCTGG + Intergenic
1049709433 8:144056988-144057010 CCTCCAGGCGGCTCAGCCTCTGG + Exonic
1054297883 9:63346598-63346620 TTTCCTGCCGGATCTGATTCAGG + Intergenic
1055247296 9:74262227-74262249 CTTCCTGAAGGATCTGCTTGTGG + Intergenic
1055922201 9:81472735-81472757 CTTCCAAGTGGACCTGCTTGGGG + Intergenic
1056350032 9:85741138-85741160 CATCCAGGGTGATCTGATTCAGG + Intronic
1057569497 9:96193755-96193777 TTTCCAGGTGGATGTGCTCCAGG - Intergenic
1057868858 9:98702735-98702757 CTTCCAGGCTTATCTTCTCCAGG + Intronic
1060080979 9:120645015-120645037 CAGTCAGGAGGATCTGCTTCAGG - Intronic
1060727849 9:126017588-126017610 TTTCCAGGAGGTTCTGCTCCTGG + Intergenic
1185486116 X:482895-482917 CTACCAGGCGGATTTGCATTTGG - Intergenic
1187300469 X:18044302-18044324 CTTCTAGGTGGGTCTGCCTCAGG + Intergenic
1190334792 X:49255777-49255799 CTGCCAGGCGGACCATCTTCTGG - Exonic
1191893603 X:65970256-65970278 CTGCCAGGCAGATCTGGTTGTGG + Intergenic
1195241873 X:102960337-102960359 CCCCCAGGGGGATCTGCTACTGG + Intergenic