ID: 1122728528

View in Genome Browser
Species Human (GRCh38)
Location 14:103777427-103777449
Sequence TTGGTTCTGGATCCTCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122728528 Original CRISPR TTGGTTCTGGATCCTCTGTC AGG (reversed) Intronic
900089972 1:915980-916002 TTCCTCCTGCATCCTCTGTCGGG + Intergenic
900725711 1:4215229-4215251 TGGGCTCTGGATCCACTGACCGG - Intergenic
902092421 1:13914042-13914064 TTGGTTCTCGAGCCTCAGCCAGG - Intergenic
910826873 1:91418508-91418530 TTCCTCCTGGATCCTCTGTCTGG - Intergenic
912478911 1:109962637-109962659 TAGGTTCTGGATTTTCAGTCTGG - Intergenic
912985164 1:114420386-114420408 TTGGTCCTGGGTCTTCTCTCTGG + Intronic
915503380 1:156336293-156336315 ATAGTTGTGGATCCTCTTTCCGG - Intronic
915717072 1:157954756-157954778 TTTGTTCTGGACCTTCTGCCTGG + Intergenic
919268228 1:195302745-195302767 TTGCATTTGGATCCACTGTCTGG + Intergenic
921904755 1:220484756-220484778 TTTCTTCTGGATCCTCTGCGTGG - Intergenic
922529846 1:226336279-226336301 TTGGTACTTGTTACTCTGTCAGG + Intergenic
1063446661 10:6122412-6122434 AAGGTTCTGGAACCACTGTCTGG + Intergenic
1063666778 10:8066171-8066193 TTGGGTCTTCTTCCTCTGTCTGG + Intronic
1065968850 10:30790097-30790119 TTGTTTCTACCTCCTCTGTCAGG - Intergenic
1066301100 10:34097065-34097087 TTCCTTATGGATTCTCTGTCTGG - Intergenic
1067064444 10:43095892-43095914 GTGGTTCTGGTTCCTCAGGCTGG - Intronic
1073540437 10:104313042-104313064 TTGGGTCTGGGTCATCTGTGTGG + Exonic
1073598673 10:104824851-104824873 TTTCTTCTGGAGCTTCTGTCAGG - Intronic
1076921351 10:133456198-133456220 TTGGTTCTGGCCCCTCTAACTGG + Intergenic
1077795192 11:5484220-5484242 TTGTTGCAGGATCCTGTGTCTGG - Intronic
1078083620 11:8220786-8220808 TGGGCTCTGGAACCTCTGACGGG + Intergenic
1081747918 11:45485978-45486000 TGGGTCCTGGAGCCTCTGACAGG + Intergenic
1085696260 11:78707301-78707323 TTGTTGCTGGATCCTTTGGCTGG - Intronic
1085876093 11:80407031-80407053 TTGCTTCAGGATGCTCTGTAAGG - Intergenic
1086114351 11:83231449-83231471 TTGGTTATTAATCCTTTGTCAGG + Intronic
1088119823 11:106355122-106355144 TTGGTTTTGGATCCTGCCTCTGG + Intergenic
1089396400 11:118138836-118138858 TGGGTGCTGTTTCCTCTGTCTGG - Intronic
1089578411 11:119463427-119463449 TTGGTTATTGATCCCTTGTCAGG + Intergenic
1090469850 11:126970509-126970531 TTTTTTCTGGACCCTCTGTGGGG - Intronic
1091336712 11:134774859-134774881 TTCCTTGTTGATCCTCTGTCTGG - Intergenic
1096523645 12:52198209-52198231 TTGATACTGGGTCCTCTGCCTGG + Intergenic
1096547958 12:52354139-52354161 TTAGTTCTGGGTTCTCTGTAAGG - Intergenic
1104574233 12:129952136-129952158 TTGGATCTCAATCCACTGTCTGG - Intergenic
1104756947 12:131275291-131275313 TTGCTTCAGGATCCTCCCTCAGG - Intergenic
1107541090 13:41389748-41389770 TTGGTTCAGGAAACACTGTCAGG - Intergenic
1110564821 13:76947490-76947512 CTGATTCTTGATCCTCTGCCTGG - Intergenic
1110792147 13:79598408-79598430 TTTGTTCTGTTTCCTTTGTCTGG - Intergenic
1115010150 14:28536665-28536687 TTGGTTCTGTCTCATCTGTGTGG + Intergenic
1118759657 14:68872368-68872390 TTGGTTCTGGATTATCTGGGTGG - Intergenic
1118868273 14:69720000-69720022 TTGGTGCTGTAGCCTCTCTCTGG + Intergenic
1122728528 14:103777427-103777449 TTGGTTCTGGATCCTCTGTCAGG - Intronic
1124242322 15:28039243-28039265 TTTGTTATTGATCTTCTGTCTGG - Intronic
1124434233 15:29634290-29634312 TTGGTGCTGGCTCCTGTGCCAGG + Intergenic
1126804525 15:52333046-52333068 TTGTTGCTGGATCCTCTGAAGGG - Intronic
1127443095 15:59031484-59031506 TTGTTTCTGTGTCCTCTGTGAGG - Exonic
1130769749 15:86912515-86912537 GTGGCTCTGAATCCTCTTTCTGG - Intronic
1131909271 15:97178668-97178690 TGGGTACTGGGGCCTCTGTCTGG - Intergenic
1132574503 16:658306-658328 GTGGTGCTGGATGCTGTGTCGGG + Exonic
1134088850 16:11378927-11378949 TTCCTTCTTGATCTTCTGTCTGG + Intronic
1137688413 16:50402769-50402791 ATGCTTCTGAATCCCCTGTCTGG + Intergenic
1138629723 16:58283712-58283734 TTTGTACTGGGTCCTCTGCCAGG - Exonic
1140499360 16:75420003-75420025 CTGGGTCTGGATCCCCTTTCAGG + Intronic
1140832554 16:78765206-78765228 CTCGTGCTGGATCCTCTGCCAGG - Intronic
1141587760 16:85046339-85046361 GTGGTTCTTCATCCTCTGTAAGG - Intronic
1143821771 17:9570347-9570369 GTGGTTCAGGATCCTCTCTCAGG - Intronic
1146418478 17:32659996-32660018 TTTTTTCAGGATCCTTTGTCAGG + Intronic
1152321453 17:79610580-79610602 TGGGGTCTGGACGCTCTGTCCGG - Intergenic
1152565514 17:81098619-81098641 CTGGATCTGGAAGCTCTGTCAGG + Intronic
1155360697 18:24997933-24997955 TTGCTTCAGCATCCTCTGCCAGG + Intergenic
1156346103 18:36258402-36258424 TTGATTCTGGATCAACTCTCTGG - Intronic
1156377487 18:36527978-36528000 ATGGTTATGGATACTCTGTGAGG - Intronic
1159802347 18:72917153-72917175 TTGCTTCTGGATGCTCTCTGGGG + Intergenic
1159922858 18:74241772-74241794 TTGGGTCTGGATCCTCTGATAGG - Intergenic
1167778312 19:51577397-51577419 TTGGTTTTGGACCCTCTTTCTGG + Intronic
1167780011 19:51593082-51593104 TTGGTTCTGGGTCCTCCCTGAGG - Intergenic
1168216581 19:54930536-54930558 TGGATTGTGGATTCTCTGTCAGG - Exonic
926553473 2:14329106-14329128 TTGGTTATGGCTCCTTTGCCCGG - Intergenic
928298958 2:30109081-30109103 TTGGTCCTAGATCCTCTTCCAGG - Intergenic
932622402 2:73272656-73272678 TTGGTTCTGCAGCCTCTAACTGG - Intronic
937172283 2:119886651-119886673 TTGGCTCTGAATTCTCTTTCAGG - Intronic
942868722 2:180708812-180708834 TTGGTTCTGGATCTTCAGAATGG + Intergenic
942878363 2:180829816-180829838 TTTGTTCTGGATCGACTGTCTGG - Intergenic
942898201 2:181083570-181083592 TCACTTCTGGATCCTCTGCCTGG + Intergenic
944462007 2:199959042-199959064 TTAATTCTGGATCCACTCTCAGG - Intronic
944633024 2:201646513-201646535 TTGTTTCTGGATCATATGTATGG - Intronic
948222667 2:236285370-236285392 TTGATGCTGCATCCTCTGTTGGG - Intergenic
1170601696 20:17846298-17846320 ATGGTTCTGGGGCCTCTGGCAGG + Intergenic
1172934525 20:38610193-38610215 TAAGTTGTGGATCCTCTCTCCGG - Intronic
1173131028 20:40393723-40393745 GTAGTTCTGGATCCTCTCCCTGG + Intergenic
1173189729 20:40866848-40866870 GTGGTTCTGGAACCTGTGTTTGG - Intergenic
1174142073 20:48422300-48422322 TAAGTTCTGGATTCTTTGTCTGG + Intergenic
1174354335 20:49988219-49988241 CTGGTTCTGTGTCCTCTGCCTGG + Exonic
1178561959 21:33646264-33646286 TTTGTTCTGAATCTTCTTTCTGG - Intronic
1178829667 21:36045324-36045346 CTCGTGCTGCATCCTCTGTCCGG - Intronic
1182094211 22:27615131-27615153 TTTCTTCTGGAGCCTCTATCTGG - Intergenic
949525894 3:4903175-4903197 TTGGTTTTGAATCCTTTGCCTGG + Intergenic
949538209 3:5012034-5012056 CTGGTTCTGGTTCTGCTGTCAGG + Intergenic
951647952 3:24914524-24914546 CTGGTTCTGGTTCCCCTCTCAGG + Intergenic
953380049 3:42463159-42463181 TTGGATCTGAATCTTGTGTCTGG - Intergenic
955020518 3:55116475-55116497 TTGTTTCTGCATCCACTGACGGG + Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956196353 3:66656896-66656918 AAGGTTCTGGCTCCTGTGTCTGG - Intergenic
956378425 3:68640583-68640605 TTGGTTGTGGAGCCTTTGTGAGG - Intergenic
966239819 3:177743854-177743876 ATTGTTCTGCATCCTATGTCAGG + Intergenic
969855161 4:9993251-9993273 TTGGATCTGGTTCTTCCGTCTGG - Intronic
973129692 4:46635581-46635603 TTGGTTCTGTCTCATCTGTGTGG + Intergenic
973537316 4:51896469-51896491 TTGGTCCTTGACCCTCTTTCCGG + Intronic
975161952 4:71134487-71134509 TTGTTTCTGTATCCTCATTCTGG + Intergenic
976493745 4:85701713-85701735 TGGGTTCTTGAACATCTGTCAGG - Intronic
977262686 4:94817083-94817105 TTGTTTCTGCATCCTCTGGAGGG - Intronic
979832501 4:125318305-125318327 TTCCGTCTGGATCCTGTGTCTGG + Exonic
981865561 4:149414172-149414194 TTGTTCCTCAATCCTCTGTCAGG - Intergenic
985126705 4:186701825-186701847 ATGTTTCTGGAGCTTCTGTCTGG - Intronic
987196111 5:15528111-15528133 TTGTTCCTGTATCCTCTTTCTGG + Intronic
987316648 5:16730650-16730672 TTGTTTCTGGCTTCTCTGGCTGG - Intronic
988537251 5:32079954-32079976 TGGGTTCTGGTTTCTCTTTCGGG + Intronic
990151100 5:52818731-52818753 TTGGTGCTGGATGCTTTGTCAGG - Intronic
993228324 5:85199250-85199272 TTGTTTCTGGGTTCTCTGTTCGG + Intergenic
994360459 5:98844158-98844180 TTGATTCTTGATTCTCTTTCTGG - Intergenic
997582232 5:135025256-135025278 TTGGGTCTGGTTCCTCTCCCAGG + Intergenic
997984765 5:138493112-138493134 TTGTTTCTGGAGGCGCTGTCGGG - Intergenic
998151272 5:139758875-139758897 TTGGTTCTGGCTCCACGGTCAGG + Intergenic
998709964 5:144812810-144812832 TTGGTTTATGCTCCTCTGTCTGG - Intergenic
999859593 5:155631510-155631532 CTGGTTTTGGATCCTCTCTCTGG - Intergenic
1000582980 5:163056567-163056589 TTGGTTATTGATCCTTTCTCAGG + Intergenic
1000712360 5:164596437-164596459 TTTGTTCTAGGTACTCTGTCAGG - Intergenic
1003965632 6:11249862-11249884 TTCCTTCTGGCTCCTGTGTCTGG + Intronic
1008607182 6:53151710-53151732 TTGGTTCTGGCTCCCCAGTGAGG + Intergenic
1009338652 6:62526325-62526347 TTGCTGCTGGATCCTCTTCCAGG + Intergenic
1013433259 6:110075293-110075315 ACAGTTCTGGATCCTCTTTCTGG - Intergenic
1014083871 6:117318919-117318941 TTGGTTCAGGATAGTGTGTCAGG - Intronic
1015375391 6:132504307-132504329 TTCGTTCTCCTTCCTCTGTCAGG - Intronic
1017607546 6:156149707-156149729 ATGGTTCTTGATCCTCTTACCGG - Intergenic
1018680241 6:166258483-166258505 TGGCTTCTGGATTCCCTGTCTGG + Intergenic
1019448014 7:1081422-1081444 TTTGTTCTGGTTCTTCTGCCCGG - Intronic
1020433586 7:8138178-8138200 ATGGTTCTGGATTCTCTTTTGGG + Intronic
1021585070 7:22199117-22199139 TTAGTTCTGGATGGCCTGTCTGG + Intronic
1024216956 7:47256037-47256059 TAGGTTCTGGTGCATCTGTCCGG - Intergenic
1026194267 7:68158945-68158967 TTCATTCTGAATTCTCTGTCTGG - Intergenic
1027785244 7:82572452-82572474 TTGATTTTGGTTCCTGTGTCTGG + Intergenic
1027996918 7:85435725-85435747 TTGGTTATTAATCCTTTGTCAGG - Intergenic
1029027369 7:97431135-97431157 TTGGCTCCTGTTCCTCTGTCTGG + Intergenic
1030328077 7:108242746-108242768 TTAGTTCTCCAGCCTCTGTCTGG - Intronic
1031702926 7:124947018-124947040 TTGGTTCTTGGTTCTCTGTCTGG - Intergenic
1033407851 7:141088069-141088091 TTGGTTCTTGATGCTCTGCGGGG + Intronic
1041104837 8:54431467-54431489 TTGGTTCTTGAACATCTGTCCGG + Intergenic
1044370798 8:91408410-91408432 TTGGATCTGGCTACACTGTCTGG + Intergenic
1048811837 8:138295405-138295427 TTGGAACTGGATCCTGTGTTGGG + Intronic
1049647620 8:143742710-143742732 GTGGTTGTGTATCCTCTGGCAGG - Intergenic
1049956233 9:695637-695659 AGGGTTCTGGATCCTCTCTGGGG + Intronic
1050151506 9:2622607-2622629 ATGGTTCTGCCTCCTCTGCCAGG + Intronic
1054810226 9:69428471-69428493 TGGGTTCTGGTGCCTCTGCCTGG + Exonic
1055071828 9:72174526-72174548 TTGGTTCTGGATTTTGTGTATGG + Intronic
1058555421 9:106161614-106161636 TTAGATCTGCATCCTCTGTAAGG + Intergenic
1058564407 9:106266467-106266489 ATGTTTCTTGTTCCTCTGTCTGG - Intergenic
1059476139 9:114549431-114549453 CTGGTTATGTATCCTCTCTCAGG - Intergenic
1193961162 X:87925894-87925916 TTGGTTCTTTCTCCTCTGTGTGG - Intergenic
1194106965 X:89781449-89781471 TTCTTTGTGGATTCTCTGTCTGG - Intergenic
1195877365 X:109555945-109555967 CTGGATCTGGACCCCCTGTCTGG + Intergenic
1197935398 X:131735216-131735238 TTGGCCCTGGCTCCCCTGTCAGG + Intergenic
1199593053 X:149485918-149485940 TTGGTTCTGGACCATCATTCGGG - Intronic
1200706401 Y:6446431-6446453 ATGGTTTTGGGTCCTCTGACAGG - Intergenic
1201027711 Y:9718277-9718299 ATGGTTTTGGGTCCTCTGACAGG + Intergenic