ID: 1122730492

View in Genome Browser
Species Human (GRCh38)
Location 14:103793441-103793463
Sequence AGCAAGGCAGCTCCTCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1183
Summary {0: 1, 1: 0, 2: 20, 3: 413, 4: 749}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122730492_1122730497 16 Left 1122730492 14:103793441-103793463 CCTTGTGGAGGAGCTGCCTTGCT 0: 1
1: 0
2: 20
3: 413
4: 749
Right 1122730497 14:103793480-103793502 TCATGATTGTAAGTTTCCTGAGG 0: 440
1: 6309
2: 8375
3: 6617
4: 4172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122730492 Original CRISPR AGCAAGGCAGCTCCTCCACA AGG (reversed) Intronic
900011840 1:119706-119728 AGCAAGCCAGCTTCTTCGCAAGG + Intergenic
900027943 1:296276-296298 AGCAAGCCAGCTTCTTCGCAAGG + Intergenic
900041898 1:475717-475739 AGCAAGCCAGCTTCTTCGCAAGG + Intergenic
900063336 1:710695-710717 AGCAAGCCAGCTTCTTCGCAAGG + Intergenic
900551662 1:3259476-3259498 AGAAAGGCAGCTGCCTCACAGGG - Intronic
900804483 1:4758462-4758484 AGCAAGGCACCTTCTTCACAAGG + Intronic
900908794 1:5579592-5579614 AGCAAGGCACCTTCTTCACAAGG + Intergenic
901210002 1:7519327-7519349 AGGAGGGCAGCTCCTGCTCACGG + Intronic
901365206 1:8741613-8741635 AGCAAGGCATCTTCTTCACAGGG - Intronic
901402840 1:9026127-9026149 AGCATAGCTGCTTCTCCACATGG + Intronic
901932808 1:12607503-12607525 AGCAAGGCACCTTCTTCACAAGG - Intronic
902123990 1:14193130-14193152 AGCAAGGCACCTTCTTCACAAGG - Intergenic
902137521 1:14322969-14322991 AGCAAGGCACCTTCTTCACAAGG + Intergenic
902727172 1:18344904-18344926 AGCCAGGCTGCTGCTCCACAGGG + Intronic
902771975 1:18650411-18650433 TGCAAGCCAGCTGCTCCACCAGG - Intronic
903684779 1:25122852-25122874 AGACAGGCAGCTCTGCCACATGG + Intergenic
904004680 1:27357534-27357556 AGCGCAGCAGCTCTTCCACATGG + Exonic
905229579 1:36506667-36506689 AGCAGATCAGTTCCTCCACAGGG - Intergenic
905369092 1:37473797-37473819 AGCAAGGGTGCTCCTCCAGTGGG + Intergenic
905899281 1:41570480-41570502 AGCAAGGCACCTTCTTCGCAAGG - Intronic
905939700 1:41853397-41853419 AGCAAGGCACCCTCTTCACAAGG + Intronic
906129040 1:43445049-43445071 AGCTGGGCAGCTCCTCCCCAGGG - Intronic
907552276 1:55314537-55314559 AGCAAGGCACCTTCTTCACAAGG + Intergenic
908223485 1:62032875-62032897 AGCAAAGCACCTTCTTCACAAGG + Intronic
908374782 1:63524131-63524153 AACAAGGCAACTCCCTCACATGG - Intronic
909022915 1:70452240-70452262 AGAAAGGCACCTTCTTCACAGGG + Intergenic
909101295 1:71352496-71352518 AGCAAGGCACCTTCTCCACAAGG - Intergenic
909189293 1:72531996-72532018 AGTAAGGCACCTCCTTCATAAGG + Intergenic
909269712 1:73607151-73607173 AGAAAGGCATCTTCTTCACAAGG + Intergenic
909667835 1:78155263-78155285 AACAATGCACCTCTTCCACATGG - Intergenic
909834826 1:80240733-80240755 AGCAAGGCATCTTCTTCACAAGG - Intergenic
910007425 1:82415995-82416017 AGCAAGGTACCTTCACCACAAGG + Intergenic
910042921 1:82875034-82875056 AGCAAGGCACCTTCTTCACAAGG + Intergenic
910056991 1:83045246-83045268 AGCAAGGCACCTTCTTCCCAAGG + Intergenic
910108698 1:83659039-83659061 AGCAAGGCACCTTCTTCACAAGG + Intergenic
910150470 1:84137032-84137054 ACCAAGGCACCTTCTTCACAAGG - Intronic
910265631 1:85334206-85334228 AGCAAAGCACCTTCTTCACAAGG - Intronic
910540404 1:88349680-88349702 AGCAAGACACCTTCTCCACAAGG + Intergenic
910558340 1:88562337-88562359 AGCAAGGTAGCTTCTTCACAAGG + Intergenic
910926258 1:92400969-92400991 AGAAAGGCACCTTCTTCACAGGG + Exonic
911253865 1:95611573-95611595 AGCAAGTCAGCCCCTCTCCATGG - Intergenic
911417189 1:97589463-97589485 AGCAAGGCACCTTCTTCACAAGG - Intronic
911472675 1:98337513-98337535 AAGAAGGCACCTTCTCCACAAGG + Intergenic
912073295 1:105840394-105840416 AGCAAGGCACCTTCTCCACAAGG - Intergenic
912557687 1:110528186-110528208 GGCAAGGCAGCTGTTCCCCAGGG - Intergenic
912597277 1:110891984-110892006 AGCAGGGCATCTTCTCTACATGG + Intronic
912600290 1:110924469-110924491 AGCAAGGTACCTTCTTCACAAGG + Intergenic
913349098 1:117838175-117838197 AGCAAGGCACCTTCTTCACAAGG + Intergenic
913398422 1:118398677-118398699 AGCAAGGCACCTTCTTCACATGG - Intergenic
913596721 1:120385747-120385769 AGCAAGGCACCTTCTACACAAGG - Intergenic
914090549 1:144493235-144493257 AGCAAGGCACCTTCTACACAAGG + Intergenic
914308058 1:146440988-146441010 AGCAAGGCACCTTCTACACAAGG - Intergenic
914324200 1:146595555-146595577 AGCAAGGCACCTTCTTCACAAGG + Intergenic
914445513 1:147747396-147747418 AGCAAGGCACCTTCTTCACAAGG + Intergenic
914594050 1:149132145-149132167 AGCAAGGCACCTTCTACACAAGG + Intergenic
915665555 1:157441084-157441106 AGAAAGGCACCTACTTCACAAGG + Intergenic
915863130 1:159469047-159469069 AGCAAGGCACCTTCTTCACAGGG + Intergenic
916304202 1:163310886-163310908 AGCAAGGCACCTTCTTCACAAGG + Intronic
916357145 1:163924377-163924399 AGCAAGGCACCTTCTTCACAAGG - Intergenic
916440040 1:164815629-164815651 AGCAAGGCAGCTTCTTCATAAGG + Intronic
916787749 1:168098542-168098564 GGGAAGGTGGCTCCTCCACAGGG + Intronic
917018383 1:170560127-170560149 AGCAAGGCACCTTCTTCACAAGG - Intergenic
917148932 1:171924510-171924532 AGCAAGGCACCTTCTTCACAAGG + Intronic
917402760 1:174669158-174669180 AGCAAGGCACCTTCTTCACAGGG + Intronic
917686298 1:177419383-177419405 AGCAAGTCAGCACCTACACTAGG - Intergenic
918053793 1:181000395-181000417 AGCAAGGCAACTTCTTCACAAGG + Intronic
918132143 1:181638828-181638850 AGCAAGGCACCTTCTTCACAAGG - Intronic
918352433 1:183671039-183671061 AGCAAGGTACCTTCTTCACAAGG + Intronic
918512653 1:185328358-185328380 AGCAAGGCACTTTCTTCACAAGG + Intergenic
918595323 1:186286441-186286463 AGGAAGGCAATTCCTCCCCAGGG - Intergenic
918613884 1:186522779-186522801 AGCAAGGCACTTTTTCCACAAGG - Intergenic
918614159 1:186524774-186524796 AGTAAGGCACCTCCTTCACAAGG - Intergenic
918832991 1:189422649-189422671 AGCAAGACACCTTCTTCACAAGG - Intergenic
918930048 1:190843273-190843295 AGCAAGGCACCTTCTTCACATGG - Intergenic
918935230 1:190913052-190913074 AGAAAGGCACCTTCTTCACAGGG + Intergenic
919167383 1:193912673-193912695 AGCAAGGCAGCCTCTTCATACGG - Intergenic
919473906 1:198011245-198011267 AGCAAGGCACATTCTTCACAAGG + Intergenic
920581960 1:207118453-207118475 AGAAAGGCACCTTCTTCACATGG + Intronic
920788038 1:209061621-209061643 ACCAAGGCAGCTGGACCACAAGG + Intergenic
920846659 1:209599062-209599084 AGTAAGGCACCTTCTTCACAAGG + Intronic
920954811 1:210608929-210608951 TGCAAGGCACCTTCTTCACAAGG + Intronic
921159739 1:212464429-212464451 AGGAAGGCAGGTGCTACACATGG - Intergenic
921318847 1:213917832-213917854 AGCAAGGCACCTTCTTCACAAGG - Intergenic
921616795 1:217277757-217277779 AGCAAGGCACCTTCTTCACAAGG - Intergenic
921865099 1:220080544-220080566 AGCAAGACACCTTCTTCACAAGG + Intronic
922002247 1:221491417-221491439 AGTAAGGCACCTCCTTCACTAGG + Intergenic
922082037 1:222306720-222306742 AGCAAGGCTGCTTTTCCACAAGG - Intergenic
922157763 1:223053385-223053407 AGCAAGCCACCTTCTTCACAAGG - Intergenic
922211018 1:223486953-223486975 AGCAAGGCACCTTCTTCACAAGG + Intergenic
922260273 1:223935718-223935740 AGCAAGCCAGCTTCTTCGCAAGG + Intergenic
922357301 1:224788546-224788568 AACAAGGCACCTTCTTCACAAGG - Intergenic
923210777 1:231802363-231802385 AGCAAGGCACCTTCTTCACAAGG - Intronic
923233227 1:232007993-232008015 AGCAAGGCACCTTCTTCACATGG - Intronic
923236891 1:232042719-232042741 AGCAAGGCACCTTCTTCAAAAGG - Intergenic
923446614 1:234077388-234077410 AGCAAGGCACCTTTTTCACAAGG + Intronic
923480607 1:234379722-234379744 AGCAAGGCACCTTCTTCACAAGG + Intronic
923999332 1:239533386-239533408 AGAAAGGCACCTTCTTCACAGGG + Intronic
924077715 1:240358598-240358620 AGCAAGGCATCTTCTTTACAAGG + Intronic
924330207 1:242933939-242933961 AGCAAGGTAGCTTCTTCACAGGG + Intergenic
924341441 1:243038266-243038288 AGCAAGCCAGCTTCTTCGCAAGG + Intergenic
924640248 1:245826766-245826788 AGCAAGGCAGCTTCCTCACAGGG + Intronic
924767682 1:247048739-247048761 AGCAAGGCACCTTCTTCACATGG + Intronic
924942764 1:248823970-248823992 GGCCAGGCATCTCTTCCACATGG + Intronic
1063930659 10:11025491-11025513 AGCCAGGCACCTCCCTCACAAGG - Intronic
1064100971 10:12463928-12463950 AGCAAGGCATCTTCTTCACAAGG - Intronic
1064181562 10:13120921-13120943 AGCAAGGCACCTTCTTCACAAGG + Intronic
1064319104 10:14285471-14285493 AGCAAAACAGCTCCTGCCCATGG + Intronic
1064464022 10:15561926-15561948 AGCAAGGTACCTTCTTCACAAGG + Intronic
1065392002 10:25192239-25192261 AGCAAGGCACCTTCTTCATAAGG - Intronic
1065502300 10:26394303-26394325 AGCAAGACACCTTCTTCACAAGG + Intergenic
1065534366 10:26702521-26702543 AGCAAGGCACCTTCTTCACTAGG - Intronic
1065574165 10:27101532-27101554 GGCCAGCCACCTCCTCCACAAGG - Intergenic
1065853411 10:29810441-29810463 AGCAAGGCGCCTTCTTCACAAGG - Intergenic
1066503435 10:36017206-36017228 AGCAAGACACCTTCTTCACAAGG - Intergenic
1066735024 10:38467150-38467172 AGCAAGGCAGCTTCTTCGCAAGG - Intergenic
1067471691 10:46542507-46542529 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1067597264 10:47567090-47567112 TGCAAGGCAGCACCTGCTCATGG - Intergenic
1067736984 10:48863860-48863882 ACCAAGGCACCTTCTTCACAAGG + Intronic
1068122491 10:52797301-52797323 AGCAAGGCACCTTTTTCACAAGG - Intergenic
1068148005 10:53096469-53096491 AGCAAGGCACCTTCTTCATAGGG - Intergenic
1068148234 10:53098442-53098464 ACCAAGGCACCTTCTTCACAGGG - Intergenic
1068286953 10:54950240-54950262 AGCAAGGCATCTTCTTCACAAGG + Intronic
1068352314 10:55863079-55863101 AACAAGGCACCTTCTTCACAAGG - Intergenic
1068424366 10:56839540-56839562 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1068540887 10:58293908-58293930 AGCAAGGCACCTTCTTCACGGGG + Intergenic
1069143633 10:64861133-64861155 AGCAAGGCACCTTTTTCACATGG + Intergenic
1069235294 10:66064126-66064148 AGCAAGGCACCTTCTTTACAAGG + Intronic
1069272435 10:66546594-66546616 AGCAAGGCACCTTCTTCACAAGG + Intronic
1069397392 10:68004723-68004745 AGCAAAGCACCTTCTTCACAAGG + Intronic
1069540038 10:69287230-69287252 AGCAAGGCACCTTCTTCATACGG + Intronic
1069584271 10:69587134-69587156 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1070144621 10:73764785-73764807 AGCCAGGCAGCTGCTCCACCAGG + Intronic
1070737626 10:78875140-78875162 AGAGAGGCAGCTCCTCTGCAGGG - Intergenic
1071306726 10:84305711-84305733 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1071822567 10:89293210-89293232 AGCAAGGCACCTTCTTCACAAGG - Intronic
1071878980 10:89874164-89874186 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1072808359 10:98440002-98440024 AGCAAGACACCTTCTTCACAAGG - Intronic
1072919437 10:99563572-99563594 AGCAAGGCACCTTCTTTACAAGG + Intergenic
1072954992 10:99880240-99880262 AGCACGGCAGCTCCTCCCCCAGG - Exonic
1073560383 10:104491465-104491487 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1073926100 10:108518630-108518652 TGCAAGGCACCTTCTTCACAAGG + Intergenic
1075059180 10:119242789-119242811 AGCAAGACACCTTCTTCACAAGG - Intronic
1075167960 10:120086139-120086161 TGCACCCCAGCTCCTCCACAGGG - Intergenic
1075812074 10:125231611-125231633 CCCAGGGCAGCTCCTCCACCAGG + Intergenic
1075980243 10:126732287-126732309 AGCAAGGCAGCTGTTTCACTTGG + Intergenic
1076082112 10:127591641-127591663 AGCAAGACACCTTCTTCACATGG + Intergenic
1076101010 10:127778127-127778149 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1076118273 10:127916384-127916406 AGCAAGGCACCTTCTTCACAAGG - Intronic
1076350057 10:129809562-129809584 CACAAAGCAGCCCCTCCACAGGG + Intergenic
1076725111 10:132409526-132409548 GGGAAGGCAGCTCCTCCCCAGGG + Intronic
1076740383 10:132479930-132479952 AGCACGGCAGCTCGGCCACCAGG - Intergenic
1076968170 11:111946-111968 AGCAAGCCAGCTTCTTCGCAAGG + Intergenic
1077417259 11:2430298-2430320 AGCAAGTCACCTTCTTCACAGGG - Intergenic
1077510772 11:2961011-2961033 ACCAAGGCAGCTCCTAGAGAGGG - Intronic
1077754027 11:5006052-5006074 AGGAAGGCACCTTCTTCACAAGG - Intergenic
1077754120 11:5006801-5006823 AGCAAGGTACCTTCTTCACAAGG - Intergenic
1078108841 11:8375766-8375788 AGCAAGGCACCTTCTTTACAAGG - Intergenic
1078187560 11:9065393-9065415 AGCAAGGTACCTTCTTCACAAGG - Intronic
1078433306 11:11303924-11303946 AGCCAGGCAGCCCCTCCAAGGGG - Intronic
1079147906 11:17870126-17870148 AGCAAGGCACCTTCTTCACAAGG - Intronic
1079157828 11:17965027-17965049 TGCCATGCTGCTCCTCCACAAGG + Intronic
1079225704 11:18602993-18603015 AGCATGGCAGCTCCTCACTAAGG - Intergenic
1079802581 11:24888883-24888905 AGCAAGGCACCTTCTTCACAAGG - Intronic
1080061202 11:27958733-27958755 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1080113967 11:28601193-28601215 AGCAAGGCACCTTATTCACAAGG - Intergenic
1080424014 11:32139665-32139687 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1080486874 11:32717843-32717865 AGCAAGGCACCTTCTTTACAAGG + Intronic
1080553886 11:33398317-33398339 ACCAATGCTGCTGCTCCACATGG + Intergenic
1080568909 11:33538094-33538116 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1080951091 11:37033799-37033821 AGCAAGGCATCTTCTCCACAAGG - Intergenic
1081226706 11:40532902-40532924 AGCAAGGCACCTTCTTCACAAGG + Intronic
1082864324 11:57884725-57884747 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1082869851 11:57934224-57934246 TGCAAGGAAGCTGTTCCACAGGG - Intergenic
1082946774 11:58769664-58769686 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1083040241 11:59679097-59679119 AGCAACGCACCTCCTTCACAAGG - Intergenic
1083523082 11:63334076-63334098 AGCAAGGCATCGCCTCAACCAGG - Intronic
1083810908 11:65106387-65106409 AGCAAGGCATCTTCTTCACAAGG + Intronic
1084551753 11:69847748-69847770 AGCAAGGCACCTTTTTCACAAGG + Intergenic
1084757237 11:71247665-71247687 AGCACGGGAGCTCCCCCAGAGGG - Intronic
1084886280 11:72209338-72209360 AGCAAGGCACATTCTTCACAAGG - Intergenic
1084895414 11:72263756-72263778 AGCAAGGCACCTTCTTCATAAGG - Intergenic
1085333603 11:75672712-75672734 AGCAAGGCACCTTCCTCACATGG + Intergenic
1085690672 11:78661432-78661454 AGCAAGGTAATTCCTGCACAAGG - Exonic
1085987003 11:81799914-81799936 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1086749470 11:90473115-90473137 AGCAAGGCATCTTCTTCACAAGG - Intergenic
1086828989 11:91535393-91535415 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1087192908 11:95274595-95274617 AGGAAGGCACCTTCTTCACAAGG - Intergenic
1087509144 11:99068033-99068055 AGCAAGGCACCTTCTTCACAAGG - Intronic
1087509841 11:99077811-99077833 GGCAAGGCACCTTCTTCACAAGG - Intronic
1087536581 11:99454492-99454514 AGCAAGGCACCTTCTTCACAAGG - Intronic
1087578652 11:100024256-100024278 AGCAAGGCACCTTTTTCACAAGG - Intronic
1087578929 11:100026249-100026271 AGCAAGGCATCTTCTTCACCAGG - Intronic
1088021829 11:105129675-105129697 AGCAAGGCATCTTCTTCACAAGG + Intergenic
1088397382 11:109383313-109383335 AGCTAGGCAGCTCCTCAATTTGG + Intergenic
1088415224 11:109581250-109581272 AGCAAGGCACCTTCTTCCCAAGG + Intergenic
1088426707 11:109712753-109712775 AGCAAGGCTCCTTCTTCACAAGG + Intergenic
1088432571 11:109775102-109775124 AGCAAAGCACCTTCTTCACAAGG + Intergenic
1089598247 11:119596236-119596258 AGCAAAGCACCTTCTTCACAAGG - Intergenic
1089620478 11:119719376-119719398 AGAGAGGCAGCTCAGCCACATGG + Intronic
1089957331 11:122583890-122583912 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1090088097 11:123668954-123668976 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1090128886 11:124118576-124118598 TGTAGGGCAGGTCCTCCACAGGG - Exonic
1090575545 11:128098935-128098957 AGCAAGGCACCTCTTTCACAAGG + Intergenic
1091967505 12:4757078-4757100 AGCAAGGCACCTTCTTCACAAGG - Intronic
1092761525 12:11815381-11815403 TGCAAGGCAACTGGTCCACATGG + Intronic
1093500824 12:19809967-19809989 AGCAAGGCAACTTCTTTACAAGG - Intergenic
1093513787 12:19960833-19960855 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1093690762 12:22106088-22106110 AGCAAAGCACCTTCTTCACAAGG + Intronic
1093765717 12:22959665-22959687 AACAAGGCACCTTCTCCACAAGG - Intergenic
1093855419 12:24095837-24095859 AGCAAGACACCTTCTTCACAAGG - Intergenic
1094297148 12:28919925-28919947 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1095216521 12:39556495-39556517 AGAAAGGCACCTTCTTCACAAGG - Intronic
1095537354 12:43266863-43266885 TGCAAGGCATCTTCTTCACAAGG + Intergenic
1095695966 12:45144414-45144436 GGCAAGGCAGTTCCTTCACATGG + Intergenic
1095749239 12:45693256-45693278 AGCAAGGCACCTTCTTCACGAGG + Intergenic
1095908404 12:47401439-47401461 AGCAAGGCATCTTCTTCAAAAGG - Intergenic
1096157274 12:49347672-49347694 TGCCAGGCAGCCCCTCCATAGGG + Exonic
1096344697 12:50835118-50835140 AGCAAAGCACCTTCTTCACAAGG - Intergenic
1096535380 12:52268986-52269008 AGCAAGGCACCTTTTTCACAAGG + Intronic
1096806411 12:54143754-54143776 AGCAGGGCAGATGCTCAACAAGG + Intergenic
1097319254 12:58207267-58207289 AGAAAGGCACCTTCTTCACAAGG - Intergenic
1097333247 12:58355178-58355200 AGCAAGGCACCTTCTTCACTAGG - Intergenic
1097678494 12:62627486-62627508 AGCAATGCACCTTCTTCACAAGG - Intergenic
1098536548 12:71599730-71599752 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1098719711 12:73881399-73881421 AGCAAAGCAGCACCTTCACAAGG + Intergenic
1098755797 12:74361804-74361826 AGCAAGGCACCTTCTTCACAGGG - Intergenic
1099314068 12:81063117-81063139 AGCAAGGCACCTTCTTCACAAGG + Intronic
1099373894 12:81872398-81872420 AGAAAGGCACCTCCTTCACAAGG + Intergenic
1099383191 12:81980747-81980769 AGCAAGGCACCCTCTTCACAAGG - Intergenic
1099438275 12:82669136-82669158 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1099572059 12:84334959-84334981 AGCAAGCCATCTTCTTCACAAGG - Intergenic
1099671774 12:85702922-85702944 AGCAAGGCACCTTCTTCACAGGG - Intergenic
1099774983 12:87114306-87114328 AGCAAGGCACCTTTTTCACAAGG + Intergenic
1099778760 12:87167038-87167060 AGCAAGGCAACTTCTTCACGTGG + Intergenic
1099790012 12:87321967-87321989 AGCAAGGGACATCCTTCACAAGG + Intergenic
1100005816 12:89893773-89893795 AACAAGGCACCTTCTTCACAGGG - Intergenic
1100006442 12:89900797-89900819 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1100086114 12:90913122-90913144 AGCAAGGCAATTTCTTCACAAGG + Intronic
1100086354 12:90915105-90915127 AGCAAGGCACCTTCTTTACAAGG + Intronic
1100290018 12:93204768-93204790 AGCAAGGTACCTTCTTCACAAGG - Intergenic
1100423063 12:94456577-94456599 AGCAAGGCACCTTCTTCACAAGG + Intronic
1100805862 12:98282906-98282928 AGCAGGGCACCTTCTTCACAAGG + Intergenic
1100908181 12:99325976-99325998 AGCAAAGCACCTTCTTCACAAGG + Intronic
1101304962 12:103519141-103519163 AGCAAGGCACCTTCTTTACAAGG - Intergenic
1101540132 12:105657637-105657659 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1104487584 12:129164639-129164661 AGCAAGGCACCTTCTTCACAAGG + Intronic
1104795743 12:131516185-131516207 AGCAAGACATCTTCTTCACAAGG - Intergenic
1105791844 13:23808496-23808518 ACCCAGGCAGCTCCTCTACCAGG + Intronic
1105912244 13:24880207-24880229 AGCAAGTCACCTTCTTCACAAGG + Intergenic
1106093202 13:26617933-26617955 AGCAAGGCACCTTCTTCACAAGG - Intronic
1106524087 13:30524472-30524494 AGCAAGGCACCTTCTTTACAAGG + Intronic
1106562296 13:30857198-30857220 GGCAGGCGAGCTCCTCCACATGG - Intergenic
1106570972 13:30927480-30927502 AGAAAAGCACCTCTTCCACAGGG - Intergenic
1106732477 13:32555876-32555898 AGCAAGTCACCTTCTTCACAAGG + Intergenic
1106936508 13:34728301-34728323 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1107217661 13:37940913-37940935 AACAAGACAGCGGCTCCACATGG + Intergenic
1107329999 13:39289206-39289228 AGCAAGGCATCTTCTTCACAAGG + Intergenic
1107744929 13:43493956-43493978 AGCAAGGCATCTTCTTCACAAGG + Intronic
1107954884 13:45502120-45502142 GTCAAGGCAGCTCCTGCAAATGG - Intronic
1107983183 13:45752878-45752900 AGCAAAGCACCTCCTTCACAAGG + Intergenic
1108197764 13:48011683-48011705 AGCAAAGCACCTTCTTCACAAGG - Intergenic
1108334134 13:49421613-49421635 ACCAAGGCCTCCCCTCCACATGG + Intronic
1108778881 13:53802835-53802857 AGCAAGGCATCTTCTTCACAAGG + Intergenic
1109122739 13:58478470-58478492 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1109418754 13:62080591-62080613 AGCAAGGCATTTTCTTCACAAGG - Intergenic
1109597747 13:64578888-64578910 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1109718492 13:66247055-66247077 AGGAAGGCACCTTCTTCACAAGG - Intergenic
1110018296 13:70436876-70436898 AGCAAGACATCTTCTTCACAAGG + Intergenic
1110178315 13:72584689-72584711 AGCAAAGCACCTTCTTCACAAGG + Intergenic
1110665906 13:78116991-78117013 AGCAAGGCCCCTTCTTCACAAGG + Intergenic
1110724363 13:78802684-78802706 AGCAAGGCACCTTCTTCATAAGG + Intergenic
1110885501 13:80628904-80628926 AGCGAGGCACCTTCTTCACAAGG - Intergenic
1110936613 13:81298329-81298351 AGAAAGGCACCTTCTTCACAAGG - Intergenic
1111010140 13:82301840-82301862 ACCAAGGCACCTTCTTCACAAGG + Intergenic
1111189692 13:84791200-84791222 AGCAAGGCACCTCCTTCACAAGG - Intergenic
1111235626 13:85404369-85404391 AGCAAGACACCTTCTACACAGGG - Intergenic
1111410310 13:87867847-87867869 AGCAAGGCACTTTCTACACAAGG + Intergenic
1111487192 13:88919271-88919293 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1111525597 13:89464512-89464534 AGCAAAGCACCTTCTTCACAAGG + Intergenic
1111754160 13:92371620-92371642 AGCAACGCATCTTCTTCACAAGG + Intronic
1111808688 13:93070181-93070203 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1112161505 13:96873100-96873122 AGCAAGGCATCTTCTTCACAAGG - Intergenic
1112257878 13:97851261-97851283 AGCAAGGCATCTTCTTCACAGGG + Intergenic
1112265456 13:97919543-97919565 AGCAAGGCACCTTCCTCACAAGG - Intergenic
1112727444 13:102320628-102320650 GGCAAGGTAGCTCCTCCCCTAGG + Intronic
1112738779 13:102450970-102450992 AGCAAAGCACCTTCTTCACAAGG - Intergenic
1112965892 13:105193202-105193224 TCCAAGGCAGCTCCCCGACACGG - Intergenic
1113041089 13:106104505-106104527 GGAATGGCAGCTGCTCCACAGGG - Intergenic
1113086307 13:106572679-106572701 AGCAAGGCACCTTCTTTACAAGG - Intergenic
1113086555 13:106574800-106574822 AGCAAGGCGTCTTCTTCACAAGG - Intergenic
1113113300 13:106847454-106847476 GGCAAGACACCTCCTTCACAAGG - Intergenic
1113166863 13:107452394-107452416 AGCAAGGCATCTTCTTCACAAGG + Intronic
1113167129 13:107454383-107454405 AGCAAGGCACCTTCTTCACTAGG + Intronic
1113211866 13:107993006-107993028 AGCAAGGCACCTTCCTCACAAGG + Intergenic
1113577961 13:111407600-111407622 AGAAGGGCAGCTCCTCGGCAGGG - Intergenic
1113639109 13:111944486-111944508 AGCCAGCCACCTCCTCCCCAGGG - Intergenic
1114338151 14:21714437-21714459 AGAAAGGCACCTTCTTCACAGGG + Intergenic
1114521321 14:23339008-23339030 AGCAAGGCACCTTCTTCATAAGG + Intergenic
1114548865 14:23522098-23522120 CGCAAGGCAGCCCCACCTCAAGG - Exonic
1114788184 14:25625184-25625206 ACCAAGGCACCTTCTTCACAAGG + Intergenic
1114820960 14:26018943-26018965 AGCAAGACACCTTCTTCACAGGG + Intergenic
1114866847 14:26605912-26605934 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1114877079 14:26733346-26733368 AGCAAGACACCTTCTTCACAGGG + Intergenic
1115190789 14:30745208-30745230 AGAAAGGGAACTCCTCCACCAGG + Intergenic
1115730623 14:36265593-36265615 AGCAAGGCACCTTTTTCACAAGG + Intergenic
1115934942 14:38542048-38542070 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1116187971 14:41623295-41623317 AGCAAAGCAGCCGCTTCACAAGG - Intronic
1116384029 14:44308961-44308983 AGCAAGGTACCTTCTTCACAAGG - Intergenic
1116386065 14:44331544-44331566 AGCAAGGCACCTTCAACACAAGG + Intergenic
1117762071 14:59039510-59039532 AGGAAGGCATCTTCTTCACAAGG - Intergenic
1118192987 14:63597133-63597155 AGCAAAGCACCTTCTTCACAAGG + Exonic
1118430009 14:65708265-65708287 AGTAAGGCACCTTCTACACAAGG - Intronic
1118831752 14:69440053-69440075 AGCAAGGCACCTTCTTCACAAGG + Intronic
1118834483 14:69467206-69467228 AGCAAGGCAGTCACTCCTCAGGG + Intergenic
1119158089 14:72429952-72429974 AGCAAGGTACCTTCTTCACAAGG - Intronic
1119547792 14:75485504-75485526 AGCAAAGCACCTTCTTCACAAGG + Intergenic
1119838424 14:77771813-77771835 AGCAAAGCACCTTCTTCACATGG - Intergenic
1119862513 14:77946771-77946793 AGCAAAGCACCTTCTTCACAAGG - Intergenic
1119975910 14:79023662-79023684 AGAAAGGCATCTTCTTCACAAGG + Intronic
1120257740 14:82141471-82141493 AGCAAGGCACCTTCTTCTCAAGG + Intergenic
1120593688 14:86407293-86407315 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1120642298 14:87029801-87029823 AGCAAGGCACCTTCCTCACATGG - Intergenic
1120802779 14:88711438-88711460 AGCAAGGCACCCTCTTCACAGGG + Intronic
1121608146 14:95256486-95256508 AGGAGGCCAGCTCCTTCACAGGG - Intronic
1121834759 14:97082028-97082050 AGCAAGGCACCTTTTTCACAAGG + Intergenic
1122089560 14:99329215-99329237 AGCAAGGCACCTTCTTCACATGG - Intergenic
1122103839 14:99436017-99436039 AGCAAGGCACCTTCTTCACAAGG + Intronic
1122364546 14:101186831-101186853 GGCACGGCATCTCCTCCCCAGGG - Intergenic
1122645471 14:103190391-103190413 AGCAAGGGACCTTCTCCACAAGG - Intergenic
1122730492 14:103793441-103793463 AGCAAGGCAGCTCCTCCACAAGG - Intronic
1202858189 14_GL000225v1_random:64260-64282 AGCAAGGCTGCCCCGGCACAGGG - Intergenic
1123881303 15:24679060-24679082 AGCATGGCTGCTGCACCACAAGG + Exonic
1124430484 15:29603496-29603518 AGCAAGGGGGCTCTCCCACAGGG + Intergenic
1125201000 15:37100637-37100659 AGCAAGCCTGCTCCTCCACGGGG + Intronic
1125246629 15:37647930-37647952 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1125299469 15:38239269-38239291 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1126232081 15:46338954-46338976 AGCAAGGCACCTTCTTCACGAGG - Intergenic
1126569154 15:50131007-50131029 AGCATGGCACCTTCTTCACAAGG + Intronic
1126784312 15:52163985-52164007 AGTCAGGCCTCTCCTCCACAGGG - Intronic
1126856855 15:52847319-52847341 GGCAAGGCACCTTCTTCACAAGG + Intergenic
1126882145 15:53110583-53110605 AGCAAAGCACCTTCTTCACAAGG - Intergenic
1127865580 15:63029893-63029915 AGGAAGGCAGCTCTTCCATCTGG - Intergenic
1129074882 15:72985415-72985437 AGCAAGGTACCTCCTTAACAAGG + Intergenic
1129583912 15:76842466-76842488 ACCAAGGCACCTTCTTCACAAGG - Intronic
1129628796 15:77235023-77235045 AGCAAGGCACCTTCTTCACAAGG - Intronic
1129629078 15:77236913-77236935 AGCAAAGCACCTTCTTCACAAGG - Intronic
1129631619 15:77266833-77266855 AGCAATCCAGCTCCTTCAAAGGG - Intronic
1129854129 15:78811813-78811835 AGCAGGGCAGCCCCTCAAAAGGG + Intronic
1130037773 15:80377286-80377308 AGCAAGGCACCTTATTCACAAGG + Exonic
1130081124 15:80734327-80734349 AGAAAGCTACCTCCTCCACAGGG - Intronic
1130123156 15:81069637-81069659 AGCAAGGCACCTCCTTCACCAGG - Intronic
1131601266 15:93851196-93851218 AGCAAGTCACCTTCTTCACAAGG - Intergenic
1131646907 15:94354501-94354523 AGCAAGGCACCTTCTTCACAAGG - Intronic
1131773333 15:95765227-95765249 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1131848971 15:96517500-96517522 AGCAAGACACCTTCTTCACAAGG + Intergenic
1132272603 15:100539503-100539525 AGCAAGGCACTTTCTTCACAAGG + Intronic
1132615684 16:840227-840249 GGCCAGGCTGCCCCTCCACAGGG - Intergenic
1132787405 16:1665328-1665350 AGCGAGGCAGCTAGTCCAAAGGG + Intronic
1132890562 16:2202343-2202365 AGCAAGGCACCTTCTCCGCAAGG + Intergenic
1133068428 16:3227692-3227714 AGCAAGGCATCATCTTCACAAGG - Intronic
1133391672 16:5415249-5415271 AGGAAGGCACCTTCTTCACAAGG + Intergenic
1134233354 16:12446621-12446643 TGCAAGGAATCCCCTCCACAGGG - Intronic
1134755493 16:16663682-16663704 AGCAAAGCACCTTCTTCACAAGG - Intergenic
1134990572 16:18695485-18695507 AGCAAAGCACCTTCTTCACAAGG + Intergenic
1135140926 16:19921467-19921489 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1135387813 16:22059601-22059623 AGCAAGGCACCTTCTTCACAAGG + Intronic
1135831929 16:25782081-25782103 AGCAAGACACCTTCTTCACAAGG + Intronic
1136117730 16:28105815-28105837 AGCATGGCAGTTATTCCACAGGG - Intronic
1136451717 16:30357562-30357584 AGGAAGCCAGCTCCACCTCATGG + Exonic
1136872353 16:33819192-33819214 AGCGAGGCATCTTCTTCACAAGG + Intergenic
1137702501 16:50507051-50507073 AGCCAGGCTGGTCCTCCACTGGG - Intergenic
1138210787 16:55161657-55161679 AGCAAGACACCTTCTTCACAAGG - Intergenic
1138499106 16:57427632-57427654 AGCAAGACACCTCCTTCACAAGG - Intergenic
1138545806 16:57718745-57718767 AGCAGGGCAACTCCTGAACAAGG - Intronic
1139083677 16:63558995-63559017 TGCAAAGCAGCACCACCACAGGG + Intergenic
1139165953 16:64565655-64565677 AGAAAGGCACCTTCTTCACAGGG - Intergenic
1139621765 16:68150893-68150915 ACCAAGGCACCTTCTTCACAAGG - Intronic
1139685902 16:68603524-68603546 AGCAAAGCACCTTCTTCACAAGG + Intergenic
1140009358 16:71115290-71115312 AGCAAGGCACCTTCTTCACAAGG - Intronic
1140444154 16:75011148-75011170 AAAAAGGCACCTTCTCCACAGGG - Intronic
1140541081 16:75756998-75757020 AGCAAGGCACCTTCTTCACAAGG + Intronic
1141305946 16:82864469-82864491 AGCAAGGCACCTTCTTCAGAAGG + Intronic
1141306256 16:82866751-82866773 AGCAAGGCACCTTCTTCACAAGG + Intronic
1142452508 16:90187200-90187222 AGCAAGCCAGCTTCTTCGCAAGG - Intergenic
1203099819 16_KI270728v1_random:1296876-1296898 AGCGAGGCATCTTCTTCACAAGG - Intergenic
1142679132 17:1535364-1535386 AGCCATGCCCCTCCTCCACAGGG + Intronic
1143336061 17:6172346-6172368 AACAAGGAAGCTCCTCTCCAAGG + Intergenic
1143338569 17:6191717-6191739 AGCAAGACAGGGCATCCACAAGG + Intergenic
1143391061 17:6559516-6559538 TGCAAGACAACTCCTCGACATGG + Intergenic
1143973007 17:10809294-10809316 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1144328801 17:14206423-14206445 AGCAAAGAAGCCCCTACACACGG - Intronic
1144495289 17:15741776-15741798 AGCCAGGGACCTCCTCCCCAGGG + Intronic
1145184001 17:20778684-20778706 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1146098775 17:29958884-29958906 ACCAAGGCAGTACCTCTACAAGG - Intronic
1147714199 17:42493296-42493318 AGCAAAGCAGTTCTTCCATAGGG - Intronic
1148046047 17:44745489-44745511 AGCAAGGCACCTTCTCCACAAGG + Intronic
1148198946 17:45735175-45735197 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1148325964 17:46783699-46783721 AGCTCGGTAGCTGCTCCACATGG - Intronic
1149047133 17:52259222-52259244 AGCAGGGCACCTTCTTCACAGGG + Intergenic
1149047203 17:52260891-52260913 AGCAAGGTACCTTCTTCACAGGG + Intergenic
1149067977 17:52503063-52503085 AGCAAGACACCTTCTTCACAAGG - Intergenic
1149363312 17:55915961-55915983 AGCAAGGCACCTTTTTCACAAGG - Intergenic
1149466683 17:56885583-56885605 AGCAAGGCATCTTTTTCACAAGG + Intergenic
1150452685 17:65282023-65282045 AGGAAGGCACCTTCTTCACAAGG - Intergenic
1150527040 17:65934903-65934925 AGAAAGACACCTCCTTCACAGGG + Intronic
1150537827 17:66062053-66062075 AGCAAGCCACCTTCTTCACAAGG - Intronic
1150572038 17:66394834-66394856 GGCAAGGCACCTTCTTCACAAGG - Intronic
1150634487 17:66903460-66903482 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1150843918 17:68635386-68635408 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1151058415 17:71060987-71061009 AGCAAGGCACTTTCTTCACATGG - Intergenic
1151143454 17:72017132-72017154 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1151787369 17:76281628-76281650 ATCAAGCCAGCTCTTCCCCATGG + Intronic
1151999757 17:77637863-77637885 TGGAAGGCAGCTCCTCCTCTGGG + Intergenic
1152667315 17:81578599-81578621 AGCAAGGCACCTTCTTCACAAGG + Intronic
1153220330 18:2855252-2855274 AGCATGGCATCTCCTCCACTGGG - Intronic
1153534426 18:6085640-6085662 AGCAAGGCACCTTCTTCACAGGG - Intronic
1153790983 18:8579165-8579187 AGCAAGGCATCACCTCAACCGGG - Intergenic
1154393491 18:13965386-13965408 AGCAAAGCACCTTCTTCACAAGG + Intergenic
1155572956 18:27215437-27215459 AGCAAGGCACTTTCTTCACAAGG + Intergenic
1155767026 18:29648861-29648883 AGCAGGGCACCTTCTTCACAAGG - Intergenic
1155942993 18:31818542-31818564 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1156413866 18:36866228-36866250 TGCTAGGCTGCTTCTCCACATGG + Intronic
1156637769 18:39051582-39051604 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1156872812 18:41967074-41967096 TGCGAGGCAGCTCACCCACATGG - Intronic
1157505402 18:48222752-48222774 AGCAGGTCCCCTCCTCCACAAGG + Intronic
1158093552 18:53744275-53744297 AGCAAAGCACCTCCTTCACAAGG + Intergenic
1158195082 18:54876102-54876124 AGCTAGGCACCTTCTTCACAAGG + Intronic
1158262229 18:55620110-55620132 AGCAAAGCACCTTCTTCACAAGG - Intronic
1158353240 18:56586796-56586818 ATCAAGGCATCTTCTTCACAAGG - Intergenic
1158565856 18:58553701-58553723 AGCAAGGCACCTTCTTCACAAGG - Intronic
1158665097 18:59425442-59425464 AGCAAGGCATCTTCTTCACAAGG - Intergenic
1158986283 18:62820628-62820650 AGCAAAGCACCTTCTTCACAAGG - Intronic
1159070016 18:63612940-63612962 AGCAAGACACCTTCTTCACAAGG + Intergenic
1159265383 18:66072847-66072869 AGCAAGGCACCTTCTTCCCAAGG + Intergenic
1159454658 18:68645209-68645231 AGAAAGGCACCTTCTTCACAGGG - Intergenic
1159481667 18:68997084-68997106 AGCAAGGCACCTTCTTTACATGG - Intronic
1159543597 18:69812781-69812803 ATCAAGGCACCTTCTTCACAAGG + Intronic
1159736796 18:72109761-72109783 AACAAGGCATCTTCTTCACAAGG - Intergenic
1159780957 18:72659893-72659915 AGCAAGGCACCTTCCTCACAAGG + Intergenic
1159852924 18:73547740-73547762 AGCAAGGCACCTTCCTCACAGGG - Intergenic
1159994776 18:74953561-74953583 AGGCAGGGAGCTCCTCCTCAAGG - Intronic
1160070089 18:75620965-75620987 AGGAAGTCAGCTCTTCCCCATGG - Intergenic
1160185624 18:76674386-76674408 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1160249440 18:77188505-77188527 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1160644979 19:181559-181581 AGCAAGCCAGCTTCTTCGCAAGG + Intergenic
1162139215 19:8575813-8575835 AGAAAGGCAACCCCTCCCCAAGG - Intronic
1162314889 19:9932785-9932807 AGGAAGGCATCTTTTCCACAAGG + Intronic
1162869508 19:13574921-13574943 GCCAAGGTAGCTCCTCCCCAGGG + Intronic
1163740998 19:19012309-19012331 AGCAAGGCAACTCCTCATCAAGG + Intronic
1164399343 19:27892045-27892067 AGCAAGCCACCTTCTTCACAAGG - Intergenic
1164517293 19:28947387-28947409 AGCAGCACAGCTCCTTCACAAGG + Intergenic
1165081394 19:33308840-33308862 AGAAAGGCACCTTCTTCACAAGG - Intergenic
1165096624 19:33413254-33413276 AGGAAGGCCACTCCTCCACACGG - Intronic
1165120519 19:33555853-33555875 AGCAAGACACCTCCTTCACAAGG + Intergenic
1166325028 19:42044147-42044169 AGCAAGGCACCTTCTTCACAAGG - Intronic
1166334920 19:42099909-42099931 AACCAGGAAGCTGCTCCACATGG + Intronic
1167178028 19:47879473-47879495 AGCAAGGCAACTTCCTCACAAGG + Intronic
1167199076 19:48051521-48051543 AGCAGGGCACCTTCTTCACAGGG + Intronic
1167199517 19:48054678-48054700 AGCAAGTCACCTTCTTCACAAGG - Intronic
925087580 2:1121635-1121657 AGCAAGGCACCTTCTTCATAAGG + Intronic
925178271 2:1799934-1799956 AGCAAGGCACCTTCTTCACAAGG - Intronic
925205546 2:2002892-2002914 AGCAAGGCACCTTCTTCACAAGG - Intronic
925354077 2:3224895-3224917 AGCACCGGAGCTCCTCCACTGGG + Intronic
925475592 2:4210867-4210889 AGTAAGGCATCTTCTTCACATGG + Intergenic
925605416 2:5655116-5655138 AGCAAGGCACCTTCTACACAAGG - Intergenic
925704477 2:6670784-6670806 AGCAAGGCACCTTCTTCACAAGG + Intergenic
925761380 2:7187943-7187965 AGCCAGGCACCTTCTGCACATGG - Intergenic
925801695 2:7608294-7608316 AGCAAGACACCTTCTTCACAAGG + Intergenic
925924944 2:8663509-8663531 AGCCAGGCACCTTCTCCACAGGG + Intergenic
926304899 2:11630890-11630912 GGAAAAGCAGCTTCTCCACATGG - Intronic
926449719 2:12987616-12987638 AGAAAGGCACCTTCTTCACAAGG + Intergenic
926709732 2:15869246-15869268 AGCAAGGCACCTTCTTCGCAAGG + Intergenic
926824564 2:16891123-16891145 AGCAAGGCACCTTCTTCACAGGG - Intergenic
926865159 2:17348497-17348519 ACCAAGGCACCTTCTTCACAAGG + Intergenic
926869103 2:17392425-17392447 AGCAAGGCATCTTCTTCACAAGG - Intergenic
927101004 2:19787775-19787797 GGCAAGGCATTTCATCCACAGGG - Intergenic
927115128 2:19892104-19892126 AGCAAGGCACCTTCCTCACAAGG + Intergenic
927213788 2:20654525-20654547 AGCAAGATAAATCCTCCACAGGG - Intergenic
928593785 2:32841825-32841847 AGCAAGGCACCTTCTTCAGAAGG - Intergenic
928800125 2:35079229-35079251 AGCAAGGCACCTTCTTCACAAGG + Intergenic
929027363 2:37617349-37617371 AGCAAGACACCTTCTTCACAAGG - Intergenic
929316575 2:40486158-40486180 AGCAAGGCACCTTTTTCACAAGG - Intronic
929490403 2:42391232-42391254 AGCAAGCCATCTCCTACTCATGG + Intronic
930283259 2:49396660-49396682 AGAAAGGCACCTTCTTCACAGGG + Intergenic
930335163 2:50036293-50036315 AGCAAGGCACCTTCTTCACAAGG - Intronic
930991051 2:57655196-57655218 TGCAAGGGAGATCCTCCACCTGG + Intergenic
931012118 2:57929308-57929330 AGCAAAGCAGCATCTCCCCAAGG + Intronic
931162351 2:59705625-59705647 AGCAAGGCACCTCCTTCACAAGG + Intergenic
931266416 2:60664499-60664521 AGAAAGGCACCTTCTTCACAGGG - Intergenic
931446363 2:62330572-62330594 AGCAAGGCACCTTCTTCACAAGG + Intergenic
932872263 2:75413714-75413736 AGCAAGGCACCTTCTTCACAAGG + Intergenic
933076005 2:77927414-77927436 AGCAAGACACCTTCTTCACAAGG - Intergenic
933450514 2:82444114-82444136 AGCAAGGCACCTTCTTCACAAGG - Intergenic
933497408 2:83067042-83067064 AGCAAGGCACCTTCTTCACAAGG + Intergenic
933624101 2:84578936-84578958 AGCAAGGCACCTTCTTCACAAGG - Intronic
933852059 2:86376077-86376099 AGCAAGGCACCTTCTTCACAAGG - Intergenic
935228483 2:101075635-101075657 AGCAAGGCACTTTCTTCACAAGG - Intronic
935304417 2:101723032-101723054 AGCCAGACATCTCCTTCACAAGG + Intronic
935702704 2:105826172-105826194 AGCAAGGCACCTTCTTCACAGGG + Intronic
935797849 2:106662998-106663020 AGCAAGGAACCTTCTTCACAAGG - Intergenic
935841995 2:107123550-107123572 AGCAAGGCAGGTCCCACAGAAGG - Intergenic
936773540 2:115944314-115944336 AGCAAGACACCTTCTTCACAAGG - Intergenic
937466537 2:122137851-122137873 AGCAAGGCACCTTCTTTACACGG + Intergenic
937508088 2:122559580-122559602 AGCAAGGCACCTTCTTCATAAGG - Intergenic
937935430 2:127240006-127240028 AGCAAGGCACCTTCTTCACAAGG - Intergenic
937991791 2:127666767-127666789 ATCAAGGCACCTTCTTCACAAGG + Intronic
938149406 2:128869013-128869035 AGCAAGGGAGCTGGGCCACATGG - Intergenic
939227496 2:139382433-139382455 AGCAAGGCACATTCTTCACATGG - Intergenic
939544333 2:143534235-143534257 AGCAAGGCACCTTCTTCTCAAGG - Intronic
939703136 2:145419544-145419566 AGCAAGGCACCTTCTTCACAAGG + Intergenic
940543427 2:155051610-155051632 AGCAAGGCACCTTCTTCACAAGG + Intergenic
940649394 2:156426326-156426348 AGCAAGACACCTTCTTCACAAGG + Intergenic
940852902 2:158705012-158705034 AGCAAGGCACCTTCTCCACAAGG - Intergenic
941468614 2:165858563-165858585 AGCAAGCTACCTCCTTCACAAGG + Intronic
941587481 2:167379144-167379166 AGCAAGGCACCTTCTTCATAAGG + Intergenic
942525652 2:176850078-176850100 AGAAAGGCATCTGCTTCACAGGG - Intergenic
942644724 2:178097386-178097408 AGCAAGGTACCTTCTTCACAAGG + Intronic
942845326 2:180417542-180417564 AGCAAGGCACCTTCTTCACAAGG - Intergenic
942885493 2:180918760-180918782 AGCAAGGCACCTTCTTCACGAGG + Intergenic
942935573 2:181552460-181552482 AGCAAGGCACATTCTTCACAAGG - Intronic
943082451 2:183271480-183271502 AGCAAGGCACCTTCTTCACAAGG - Intergenic
943341012 2:186682311-186682333 AACAAGGCACCTTCTTCACAAGG + Intergenic
943373458 2:187045704-187045726 AACAAGGCACCTTCTTCACAAGG - Intergenic
943463352 2:188197563-188197585 AACAAGGCACCTTCTTCACAAGG + Intergenic
943878657 2:193109018-193109040 AGGAAGGCACCTCCTTCACAAGG - Intergenic
944096834 2:195976878-195976900 ACCAAGGCAGTACCTCTACAAGG + Intronic
944141494 2:196461676-196461698 AGCAAGGCACCTTCTTCACAAGG + Intronic
945001485 2:205355814-205355836 AGCAAGGCATCTTCTTCACAAGG + Intronic
945358014 2:208861334-208861356 AGCAAGGCACCTTCTTCACAAGG - Intergenic
945758528 2:213881594-213881616 AACAAGGCACCTTCTCCACAAGG + Intronic
945818099 2:214630413-214630435 AGCAAGGCACCTTCTTCACAAGG + Intergenic
946023132 2:216655450-216655472 AGCAAGGCACCTTCTTCACAAGG - Intronic
946041967 2:216790509-216790531 GGTAAGGCAGCTCCTCTTCACGG - Intergenic
946413452 2:219527104-219527126 GGCACGGCAGCTCTGCCACAAGG - Intronic
946440193 2:219688499-219688521 AGCAAGGCACCTTCTTCACAAGG - Intergenic
946461057 2:219869391-219869413 AGTAAGGCACCTTCTTCACAAGG + Intergenic
946483090 2:220075234-220075256 AGCAAAGCACCTTCTTCACAAGG - Intergenic
946543848 2:220715398-220715420 AGCAAGGCACCTTCTTCACAAGG + Intergenic
946808454 2:223496619-223496641 AGCAAGGCACCTTCTTCCCAAGG - Intergenic
946985627 2:225269594-225269616 AGCAAGGCATCTTTTTCACAAGG + Intergenic
946985998 2:225273936-225273958 AGCAAGGCACCTTATTCACAAGG - Intergenic
947032364 2:225811515-225811537 AGCAAGGTACCTTCTTCACAAGG + Intergenic
947230683 2:227882839-227882861 AGCAAGGCACCTTCTTCACAAGG - Intronic
947236684 2:227948773-227948795 AGCAAGGCACCTTCTTCACAAGG - Intergenic
947236976 2:227950895-227950917 AGCAAGGCACCTTCTTCACAAGG - Intergenic
947364082 2:229376027-229376049 AGCAAGTCACCTTCTTCACAAGG - Intronic
947474969 2:230436525-230436547 ACCAAGGCACCTTCTTCACAAGG - Intronic
947777155 2:232722312-232722334 AGCAAGGCACCTTCTACACAAGG + Intronic
947965936 2:234281624-234281646 GGCAAGGCAGCTCCCTCAGAGGG - Intergenic
948397589 2:237658649-237658671 ACCAAGGCACCTTCTTCACAAGG + Intronic
949083950 2:242131859-242131881 AGCAAGCCAGCTTCTTCGCAAGG - Intergenic
1168820290 20:768538-768560 ATCCTGGCAGCTCCTCCCCACGG + Intergenic
1169395306 20:5223881-5223903 AGCAAGGAAGATCTTGCACAAGG - Intergenic
1169415595 20:5413402-5413424 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1169578389 20:6991501-6991523 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1169619652 20:7491251-7491273 ATCAAGGCACCTTCTTCACAAGG - Intergenic
1169640577 20:7746258-7746280 AGCAAGGCACCTTCTTCATAAGG + Intergenic
1170057833 20:12226545-12226567 AGCAAGGCACCTTCTTCACAGGG - Intergenic
1170370870 20:15646757-15646779 AGCAAGGCACCTTTTTCACAAGG - Intronic
1171171090 20:23015865-23015887 AGCAAAGCAGTTCCTGCAAATGG + Intergenic
1173279046 20:41611026-41611048 AGCAAGGCAGCTGTTCCAGCGGG - Intronic
1173373437 20:42460735-42460757 AGCAAGGCACTTTCTTCACAAGG - Intronic
1173422154 20:42910918-42910940 AACAAGGCACCTTCTTCACAAGG + Intronic
1173493371 20:43501295-43501317 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1174729668 20:52903421-52903443 AGCAAGGTAACTTCTTCACAAGG + Intergenic
1174872769 20:54199074-54199096 AGCAAGGCACCTTCTTAACAGGG - Intergenic
1174959957 20:55144655-55144677 AGCAAGGCACCCCCTTCACAAGG - Intergenic
1174987225 20:55468503-55468525 AGCAAAGCACCTTCTTCACAGGG - Intergenic
1175503087 20:59464046-59464068 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1175539499 20:59739503-59739525 AGCAAGGCACCTTCTTCACAAGG + Intronic
1175619884 20:60434543-60434565 AGCAAGACACCTTCTTCACAAGG - Intergenic
1175818395 20:61895651-61895673 AGCAGGGCAGCTGCACCACCAGG + Intronic
1175861580 20:62153102-62153124 AGCAAGGCACCTTCTTCACAAGG + Intronic
1176280535 20:64304350-64304372 AGCAAGCCAGCTTCTTCGCAAGG - Intergenic
1176362521 21:6009909-6009931 AGCAAGGCACCTTCTTCTCAAGG + Intergenic
1176951060 21:15047179-15047201 AGCAAGGCACCTTCTTCACAAGG + Intronic
1177367482 21:20156245-20156267 AGAAAGGCAACTTCTTCACAGGG - Intergenic
1177476894 21:21634891-21634913 AGCAAGACACCTTCTTCACAAGG + Intergenic
1177560485 21:22744502-22744524 AGCAAGGCACCTTCTTTACAAGG + Intergenic
1177873404 21:26600677-26600699 AGCAAGGCATCTTCCTCACAAGG - Intergenic
1178041413 21:28644201-28644223 AGCAAGGCACCTTCGTCACAAGG + Intergenic
1178622633 21:34189809-34189831 AGCAAGACACCTTCTTCACAAGG - Intergenic
1178751064 21:35303494-35303516 AACAAGGCATCTCCTTCACATGG + Intronic
1178939099 21:36890096-36890118 AGCAAGGCACCTTCTTCACAAGG - Intronic
1179230406 21:39498986-39499008 AGCAAGGCACCTTCTTCACAAGG + Intronic
1179349160 21:40591155-40591177 AGTAAGGCACCTTCTTCACAAGG - Intronic
1179760997 21:43528636-43528658 AGCAAGGCACCTTCTTCTCAAGG - Intergenic
1179916499 21:44481327-44481349 AGCAAGGCACCTTCTTCAGAAGG + Intergenic
1180187670 21:46147553-46147575 AGCAAAGCAGCCTCACCACAAGG + Intronic
1180787533 22:18555157-18555179 AGTAAGGCAGCTGCTCTGCAAGG + Intergenic
1181234206 22:21440148-21440170 AGTAAGGCAGCTGCTCTGCAAGG - Intronic
1181244441 22:21494683-21494705 AGTAAGGCAGCTGCTCTGCAAGG + Intergenic
1181522537 22:23457832-23457854 AGCAAGACAGCTGCTCCCAATGG - Intergenic
1182314873 22:29439004-29439026 AGCAAAGTAGATCCTCCCCATGG - Exonic
1182536875 22:31010402-31010424 AGCAAGGTACCTTCTTCACAAGG - Intergenic
1182695075 22:32193040-32193062 AGCAAAGTAGATCCTCCCCATGG + Exonic
1182716277 22:32358284-32358306 AGCAAAGCAGATCCTCCCCATGG - Exonic
1182817421 22:33177972-33177994 AGCAAGGTACCTTCTTCACAAGG - Intronic
1182961363 22:34478341-34478363 AGCAAGGCATCTTTTTCACAGGG - Intergenic
1183004385 22:34889016-34889038 AGCAAGGCACCTTCCTCACAAGG - Intergenic
1183029358 22:35091820-35091842 AGCAAGTCACCTCCTTCACGTGG + Intergenic
1183341311 22:37283485-37283507 AGCAAGGGTGCTCCTGGACAAGG - Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184475181 22:44716572-44716594 AACAAGGCATCTACTCCTCAGGG - Intronic
1184837933 22:47035160-47035182 TGCAGGGCAGCTCCTCCAGATGG - Intronic
1184872319 22:47248752-47248774 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1185114626 22:48924828-48924850 AGTAAGGCACCTTCTTCACAAGG - Intergenic
1185391328 22:50562914-50562936 AACAAGGCCGCTCCTCGAGAGGG + Intergenic
949282292 3:2360648-2360670 AGCAAGGAACCTTCTTCACAGGG + Intronic
949733424 3:7142423-7142445 AGCAGGGCACCTTCTTCACAAGG + Intronic
949768369 3:7551937-7551959 AGCAAGGCATCTTCTTCACAAGG + Intronic
950196883 3:11015597-11015619 AGGCAGGCAGCTCCTACAGAGGG - Intronic
950854302 3:16091162-16091184 AGCATGCCAGTTCCTCCCCATGG + Intergenic
950913083 3:16615406-16615428 GGCAAGGCACCTTCTTCACAAGG - Intronic
950913346 3:16617381-16617403 AGCAAGGCACCTTCTTCACAAGG - Intronic
951181529 3:19664749-19664771 AGCAAGGCACCTTCTTTACAAGG - Intergenic
951395465 3:22160073-22160095 AGCAAGGCACCTTCTTCACAAGG - Intronic
951470119 3:23046685-23046707 AGAAAGGCACCTTCTTCACAGGG - Intergenic
951760943 3:26146974-26146996 AGCAAGGCACCTTTTTCACATGG - Intergenic
951865966 3:27308140-27308162 AGCAAGGCACCTTCTTCACAAGG + Intronic
951949785 3:28187189-28187211 AGCAAGGCATCTTCTTCACAAGG + Intergenic
952091127 3:29887487-29887509 AGCAAGATACCTTCTCCACAAGG - Intronic
952295363 3:32057533-32057555 AGCAAGGCACCTTCTTAACAGGG + Intronic
952622021 3:35356442-35356464 AGCAAGGTACCTTCTTCACAAGG + Intergenic
953456420 3:43045890-43045912 AGCAAGGAACCTTCTTCACAAGG - Intronic
953489632 3:43337725-43337747 AGCAAGGCACCTTCTTCACAAGG + Intronic
953591521 3:44260089-44260111 AGCAAGGCCCCTTCTTCACAAGG - Intronic
955062471 3:55505222-55505244 AGCAAGGCACTTTCTTCACAAGG + Intergenic
955739510 3:62075227-62075249 AACAATGCTGCTCCTGCACATGG + Intronic
955886142 3:63600720-63600742 AGCAAGGCATCTTCTTCACAAGG - Intronic
956347947 3:68300842-68300864 AGCAAGGCACCTTTTTCACAAGG - Intronic
956534397 3:70259884-70259906 AGCAAGGCACCTTCTTCACAAGG + Intergenic
957416181 3:79908661-79908683 AGCAAGGCACCTTCTTCACAAGG + Intergenic
957425564 3:80034922-80034944 AGCAAAGCACCTTCTTCACAAGG + Intergenic
957544865 3:81624137-81624159 AGCAAGGCACCTTCTTCACAAGG + Intronic
957875404 3:86139571-86139593 AGCAAGACACCTTCTTCACAAGG - Intergenic
958196123 3:90244562-90244584 AGCAAGGCACCTTCTTCACAAGG - Intergenic
958419314 3:93913207-93913229 AGCAAGGCATCTTCTTCACAAGG - Intronic
958672313 3:97220541-97220563 AGCAAGGGACCTTCTTCACAAGG + Intronic
958783929 3:98576265-98576287 AGCAAGGCACCTTCTTCACAAGG + Intronic
958935268 3:100249896-100249918 AGCAAGACACCTTCTTCACAAGG + Intergenic
959143530 3:102515653-102515675 AGCAAGGCATCTTCTTCCCAAGG - Intergenic
959274279 3:104257825-104257847 AACAAGGCACCTTCTCTACAAGG - Intergenic
959299286 3:104577834-104577856 AGCAAGACACCTTCTTCACAAGG + Intergenic
959302328 3:104618989-104619011 AGCAAGGCACCTTCTTCATAAGG - Intergenic
959601423 3:108190514-108190536 AGCAAGGCATCTTCTTTACAAGG - Intronic
960257609 3:115527551-115527573 AGCAAGGCACCTTCTTCACAAGG - Intergenic
960424717 3:117492426-117492448 AGAGAGGCACCTTCTCCACAGGG - Intergenic
960481066 3:118190603-118190625 AGAAAGGCACCTTCTTCACAAGG - Intergenic
960509321 3:118529541-118529563 AGCAAAGCACCTTCTTCACAAGG + Intergenic
960881771 3:122352646-122352668 AGCAAGGCTTCTCCCCCAAAAGG + Intergenic
961179873 3:124868091-124868113 AGCAATGCACCTTCTTCACAAGG - Intronic
961346872 3:126268658-126268680 AGCAGGGCAGCCCCTGCAGAGGG + Intergenic
961443653 3:126967673-126967695 AACAAAGCAGCTCCTTCACCTGG - Intergenic
961471712 3:127117852-127117874 AGCAAGACACCTTCTTCACAAGG - Intergenic
962107262 3:132403920-132403942 AGCAAGGCACCTTCTTCACAAGG - Intergenic
962167045 3:133060232-133060254 CACAAGGCAGCTCCCCAACATGG - Intronic
962173440 3:133127325-133127347 AACATGGCAGCCACTCCACAGGG - Intronic
962517267 3:136163855-136163877 AGCAGGGCACCTTCTTCACATGG - Intronic
962612206 3:137087445-137087467 AGCAAGGCACCTTCTTCACAAGG - Intergenic
963538800 3:146561449-146561471 AGCAAGGCATGTCCTTCACAAGG + Intergenic
964275255 3:155002946-155002968 AGCAAGGTACCTTCTTCACAAGG - Intergenic
964275637 3:155005740-155005762 AGCAAGGTACCTTCTTCACAAGG - Intergenic
964903211 3:161686154-161686176 AGCAAGGCACCTTCCTCACAAGG - Intergenic
964929598 3:162001013-162001035 AGCAAGGTACCTTCTTCACAAGG - Intergenic
964966041 3:162495192-162495214 AGCAAGTCACCTTCTTCACAAGG + Intergenic
964966296 3:162497183-162497205 AGCAGGGCACCTTCTTCACAAGG + Intergenic
965441836 3:168723985-168724007 AGCAAGGCACCTTCTTCACAAGG - Intergenic
965950616 3:174303779-174303801 AGCAAGGCACCTTCTTCACAAGG - Intergenic
965957486 3:174388882-174388904 AGCAAGGCACCTTCTTCACAAGG + Intergenic
965965448 3:174483315-174483337 AGCAAGTCACCTTCTTCACAAGG + Intronic
966414629 3:179676134-179676156 AGAAAGGCACCTTCTTCACAGGG - Intronic
967191975 3:186992305-186992327 AGCAAGGCACCTTCCTCACAAGG - Intronic
967586217 3:191217130-191217152 AGCAAGGCACCTTCTTCACAAGG + Intronic
967759222 3:193204905-193204927 TGGAAGGCAGCCCCTCCACTAGG - Intergenic
967840977 3:194004178-194004200 AGCAGGCCAGCTCCGCCACAAGG + Intergenic
968015933 3:195332785-195332807 AGCAAGGCATCTTTTTCACAAGG - Intronic
968018161 3:195357875-195357897 AGCAAGGCATCTTTTTCACAAGG + Intronic
968517579 4:1021315-1021337 AGAAAGGCTGCGGCTCCACATGG - Intronic
969120083 4:4902065-4902087 AGCAATGCGTCTTCTCCACAAGG + Intergenic
969136097 4:5030008-5030030 AGCAAGGCACTTTCTTCACAAGG - Intergenic
969293569 4:6255926-6255948 AGCAAGGCACCTTCTTCACAAGG - Intergenic
969441462 4:7219562-7219584 AGCAAGGCGACTTCTTCACAAGG + Intronic
969447545 4:7253733-7253755 GGCAAGGCAGCCCCTCCAGGTGG + Intronic
969613585 4:8240070-8240092 CCCCAGGCACCTCCTCCACATGG - Intronic
969635726 4:8368552-8368574 ACCCAGGCTGCTGCTCCACAGGG + Intronic
970143968 4:13013702-13013724 AGCAAGGCACCTTCTTCACAAGG + Intergenic
970150208 4:13081694-13081716 AGCAAGGCACATTCTTCACAAGG + Intergenic
970150402 4:13083145-13083167 AGCAAGGCATATTCTTCACAAGG + Intergenic
970403970 4:15744360-15744382 AGCAAGGCACCTTCTTCACAAGG + Intergenic
970577579 4:17443257-17443279 AGCAAGGCACCTTCTTCACAAGG + Intergenic
970715074 4:18912430-18912452 AGCAAGGCACCTCCTTCCCAAGG - Intergenic
970735669 4:19164526-19164548 AGCAAAGCACCTTCTTCACAAGG - Intergenic
970780725 4:19734476-19734498 AGCAAGGCACCTTCTTCACAAGG + Intergenic
970807185 4:20050509-20050531 AGCAAGGCACCTTCTTCACAAGG - Intergenic
970858787 4:20678267-20678289 ATGAGGGCAGCTCCTCCAGAGGG + Intergenic
970866318 4:20762928-20762950 AGGAAGGCACCTTCTTCACAAGG + Intronic
970905294 4:21208859-21208881 AGCAAGACACCTTCTTCACAAGG + Intronic
971072592 4:23111430-23111452 AGACAGGCAGCTTCTTCACAAGG + Intergenic
971276070 4:25198144-25198166 AGAAAGGCACCTTCTTCACAAGG - Intronic
971591469 4:28474200-28474222 CGCAAGGCACCTTCTTCACAAGG - Intergenic
971832382 4:31712627-31712649 AGCAAGGCACCTTCTTCACAAGG - Intergenic
972010080 4:34168044-34168066 AACAAGGCACCTGCTTCACAAGG + Intergenic
972015390 4:34236781-34236803 AGCAAGGCACTTTCTTCACAAGG + Intergenic
972113507 4:35596283-35596305 AGCAAGGCACCTTCTTCACAAGG + Intergenic
972363020 4:38346256-38346278 AGCAAGGTACCTGCTTCACAAGG - Intergenic
972845128 4:42978977-42978999 AGCAAGGCACCTTCTTCACAAGG - Intronic
972978792 4:44670262-44670284 AGCAAGGCACCTTCTTCACAAGG - Intronic
973034101 4:45383950-45383972 AGCAAGGCAGCTTCTTCACAAGG - Intergenic
973175679 4:47202263-47202285 AGCAAGGCACCTTCTTCACAAGG - Intronic
973855550 4:55007099-55007121 AGTAAGGCACCTTCTTCACAAGG - Intergenic
974125552 4:57691971-57691993 AGCAAGGCACCTTCTTCACAAGG - Intergenic
974163964 4:58176243-58176265 AGCAAGGCACCTTCTTCACAAGG - Intergenic
974302860 4:60092309-60092331 AGCAAGGTACCTTCTTCACAAGG + Intergenic
974728769 4:65834257-65834279 AGCAAGGCACCTTCTTCACAAGG + Intergenic
974746529 4:66084905-66084927 AGCAAGGCACCTTCTTCACAAGG - Intergenic
974852191 4:67416928-67416950 AGCAAGGCAGCTTCTTCACAAGG - Intergenic
975229989 4:71922109-71922131 AGCAAGGCACCTTCTTCACAAGG + Intergenic
975302188 4:72802887-72802909 AGCAAGGCACCTTCTTCATAAGG + Intergenic
975318297 4:72980253-72980275 AGCAAGGTACCTTCTTCACAAGG - Intergenic
975388043 4:73781568-73781590 AGCAAGGCACTTACTTCACAGGG + Intergenic
976075952 4:81299007-81299029 AGCAAGGCAACTTCTTCACAGGG - Intergenic
976248055 4:83023250-83023272 AGCAAAGCACCTACTTCACAAGG - Intergenic
976573130 4:86636262-86636284 ACCAAGTGACCTCCTCCACAGGG - Intronic
976640313 4:87330912-87330934 AGCAAGGCACCTTCTTCACAAGG + Intergenic
976804097 4:89026587-89026609 AGCGAGGCACCTTCTTCACAAGG + Intronic
976823674 4:89235312-89235334 AGCAAGGCACCTTCTTCACAAGG - Intergenic
976871854 4:89803793-89803815 AGCAAGGCACCTACTTCACAAGG - Intronic
976936410 4:90640779-90640801 AGCAAGGCACCTTCTTCACAAGG - Intronic
976966032 4:91042296-91042318 ATGAAGGCACCTCCTTCACAAGG - Intronic
977086475 4:92605038-92605060 AGCAAGGCATCTTCTTCACAAGG - Intronic
977138732 4:93339825-93339847 AGCAAGGCACCTTCTTCACAAGG + Intronic
977645524 4:99407392-99407414 AACAAGGCACCTTCTTCACAAGG + Intergenic
977719257 4:100220717-100220739 AGCAAGACATCTTCTTCACAGGG + Intergenic
977926436 4:102705529-102705551 AGCAGGGTAGCCCTTCCACAGGG - Intronic
978023336 4:103840990-103841012 AGCAAGGCATCTTCTTCACAAGG - Intergenic
978240118 4:106505052-106505074 AGCAAGGCACATTCTTCACAAGG - Intergenic
978809615 4:112836252-112836274 AGCAAGGCACCTTCTTCACAAGG - Intronic
979126194 4:116975481-116975503 AGCAAGTCACCTTCTTCACAAGG + Intergenic
979236144 4:118402536-118402558 AGCAAGGCACCTTCTTTACAAGG + Intergenic
979261383 4:118650099-118650121 AGCAAGGCAGCATCTTCGCAAGG - Intergenic
979894052 4:126135479-126135501 AGCAAGGCACCTTCTTCACAAGG - Intergenic
979930679 4:126626255-126626277 AGCAAGGCATCTTCTTCACAAGG - Intergenic
979941034 4:126763245-126763267 AGCAAGGCACCTTCTTCACAAGG + Intergenic
979963171 4:127046046-127046068 AGCACATCAGCTCCTCCAAAAGG + Intergenic
980338784 4:131513622-131513644 AGCAAGGCACCTTCTTCATAAGG - Intergenic
980487010 4:133471309-133471331 AGCAAGGCACCTTCTTCACAAGG - Intergenic
980515463 4:133852202-133852224 AGCAAGGTAACTTCTTCACAGGG - Intergenic
980635071 4:135491662-135491684 AGGAAGGCACCTTCTTCACAAGG + Intergenic
980645592 4:135638426-135638448 AGCAAGGCACCTTCTTCACAAGG + Intergenic
980647606 4:135662720-135662742 AGCAAGGCACCTTCTTCACAGGG - Intergenic
980751615 4:137097394-137097416 AGCAAGTCACCTTCTTCACAAGG - Intergenic
980782159 4:137505058-137505080 AGCAAGGTACCTTCTTCACAAGG + Intergenic
980846347 4:138329841-138329863 GGCAAGGCTGCTCCTCCAGCCGG + Intergenic
980882974 4:138732297-138732319 AGCAAGGCACCTTCTTCACAAGG + Intergenic
981654903 4:147102032-147102054 AGCAAGGCAGGCCCTGGACAAGG + Intergenic
982302547 4:153894623-153894645 AACAAGGCACCTTCTTCACAAGG + Intergenic
982417407 4:155152143-155152165 AGCAAGGCACCTTCTTCACGAGG + Intergenic
982593772 4:157351812-157351834 AGCAAGGCACCTTCTTCACAAGG - Intronic
982923605 4:161306331-161306353 AGCAAGGCACCTTCTTCACAAGG + Intergenic
983053808 4:163079001-163079023 AGCAAGGCAACTTCTTCACAAGG - Intergenic
983150454 4:164273233-164273255 AGCAAGGCAGCTTCTTCACAAGG + Intronic
983709184 4:170693442-170693464 AGCAAGGAACCTTCTTCACAGGG + Intergenic
983932043 4:173463164-173463186 CCCAAGGCAGCTCTTCCACAGGG - Intergenic
984214214 4:176888038-176888060 AGCAAGGCCCCTTCTTCACAAGG - Intergenic
984388717 4:179099641-179099663 AGCAAGGCACCTTCCTCACAAGG + Intergenic
984699992 4:182812997-182813019 AGCAAGGCACCTTCTTCACAGGG + Intergenic
985431939 4:189889354-189889376 AGCAAGTCACCTTCTTCACAAGG + Intergenic
985576152 5:674372-674394 GGCAGGGCAGCTCCTCCCCTTGG - Intronic
985802922 5:2017493-2017515 AGCAAGGCACCTTCTTCACAAGG - Intergenic
986003702 5:3650057-3650079 AGAATGGCAGCTTCTTCACAAGG - Intergenic
986401453 5:7385684-7385706 AGCAAGGAACCTCCTTCACAAGG + Intergenic
986449897 5:7853291-7853313 AGCAAGGCACCTTCTTCACAAGG - Intronic
986517990 5:8583111-8583133 AGCAAGGCACCTGCTTCCCAAGG - Intergenic
986914052 5:12594739-12594761 AGCAAGGCCCCTTCTTCACATGG + Intergenic
986942996 5:12979446-12979468 AGCAAGGTACCTTCTTCACAAGG + Intergenic
986987232 5:13513608-13513630 AGCAAGGCACCTTCTTCCCAAGG - Intergenic
986987496 5:13515590-13515612 GGCAAGGCACCTTCTTCACAAGG - Intergenic
986991964 5:13564698-13564720 AGCAAGGCACCTGCTTCACAAGG - Intergenic
987020656 5:13867429-13867451 AGCAAGGCACCTTCTTCACAAGG - Intronic
987149999 5:15028831-15028853 AGCAAGGAACCTTCTTCACAAGG + Intergenic
987162034 5:15154828-15154850 AGCAAGGCACCTTCTTCACAAGG + Intergenic
987441669 5:17964562-17964584 AGCAAGGCGCCTTCTTCACAAGG + Intergenic
987463028 5:18236992-18237014 AGCAAGGAACCTTCTTCACAAGG + Intergenic
987465390 5:18265978-18266000 AGCAAGGCACATTCTTCACAAGG + Intergenic
987496262 5:18648733-18648755 AGCAAGTCACCTTCTTCACAAGG - Intergenic
987501877 5:18721921-18721943 AGCAAGGCACCTTTTTCACAAGG - Intergenic
987509990 5:18825018-18825040 AGCAAGGCACCTTCTTCACAAGG + Intergenic
987683217 5:21164480-21164502 AGCAAGGCACCTTCTTCACAAGG + Intergenic
987726979 5:21716040-21716062 AGCAAGGCACCTTGTTCACAAGG + Intergenic
987736991 5:21859293-21859315 AGAAAGGCACCTTCTTCACAGGG + Intronic
987741817 5:21918545-21918567 AGCAAGGCACCTTCTTCACAAGG + Intronic
987748839 5:22013214-22013236 AGCAAGGAATCTTCTTCACAAGG + Intronic
987843222 5:23247309-23247331 AGCAAGGCAGCTTCTTCACAGGG - Intergenic
987893923 5:23919768-23919790 AGCAAGGCACCTTCATCACAAGG - Intergenic
988230168 5:28466409-28466431 AGCAAGGCACCTTCTTCACAAGG - Intergenic
988628180 5:32899974-32899996 AGCAAGGCACCTTCTTCACAAGG + Intergenic
988628415 5:32901742-32901764 AGCAAGGCACCTTCTTCACAAGG + Intergenic
988701484 5:33679423-33679445 AGCAAGGCACCTTCTTCACAAGG + Intronic
988982313 5:36583994-36584016 TGCAAGGCAGCTCATCCCAAGGG + Intergenic
989125362 5:38047552-38047574 AGAAAGGCTTCTCCTGCACAGGG + Intergenic
989439608 5:41454945-41454967 AACAAGGCACCTTCTTCACAAGG + Intronic
989697044 5:44213444-44213466 AGCAAGGCACTTTCTTCACAAGG - Intergenic
990021265 5:51129578-51129600 AGCAAGGCACCTTCTTCACAAGG - Intergenic
990032893 5:51283220-51283242 AGCAAGACACCTTCTTCACAAGG - Intergenic
990135905 5:52644107-52644129 AGCAAGGCACCTTCTTCACAAGG - Intergenic
990266425 5:54081655-54081677 AGCAAGGCACCTTCTTCACAAGG - Intronic
990484106 5:56241298-56241320 AGCAAGGCACCTTCTTCACAAGG - Intergenic
990623634 5:57587506-57587528 AGCAAGGCGCCTTCTTCACAGGG - Intergenic
990786334 5:59424540-59424562 AGAAAGGCATCTTCTTCACAGGG + Intronic
990849937 5:60191479-60191501 AGCAAGACACCTTCTTCACAAGG - Intronic
991075969 5:62538551-62538573 GGCAAGGCATCTTCTTCACAGGG - Intronic
991126208 5:63072513-63072535 AGCAAGACACCTTCTTCACAAGG - Intergenic
991165296 5:63560334-63560356 AGCAAGGCACCTTCTTCAAAAGG + Intergenic
991226855 5:64283684-64283706 AGCAAGGCACCTTCATCACAAGG - Intronic
991769025 5:70022985-70023007 AGCAAGGAAACTTCTTCACAAGG + Intergenic
991848320 5:70898403-70898425 AGCAAGGAAACTTCTTCACAAGG + Intergenic
992033264 5:72745751-72745773 AGCAAGGCACCTTCTTCACAAGG + Intergenic
992817757 5:80462337-80462359 AGCAAGGCACCTTCTTCACAAGG + Intronic
992818036 5:80464309-80464331 AGCAAAGCACCTTCTTCACAAGG + Intronic
993039195 5:82793038-82793060 AGCAAGGCACCTTCTTCACAAGG - Intergenic
993331997 5:86612347-86612369 AGCAAGGCACCTTCTTCACAAGG + Intergenic
993732063 5:91433957-91433979 AGCAAGACACCTTCTTCACAAGG - Intergenic
993769697 5:91910903-91910925 AGCAAGGCACCTTCTTCACAAGG - Intergenic
993777138 5:92013175-92013197 AGAAAGGCACCTTCTTCACAGGG - Intergenic
994271886 5:97787203-97787225 AGCAAGACACCTTCTTCACAAGG - Intergenic
994576924 5:101590118-101590140 AGCAAGGCATCTTATTCACAAGG + Intergenic
994776501 5:104041566-104041588 AGCAAGGCATCTTCTTCACAAGG + Intergenic
994785530 5:104156549-104156571 AGCAAGGCACATTCTTCACAAGG - Intergenic
995244313 5:109919385-109919407 AGCAAGGCACCTTCTTCACAAGG - Intergenic
995353906 5:111215114-111215136 AGCAAGGCACCTTCTTCACAAGG - Intergenic
995413919 5:111888390-111888412 AGCAAGGCAACTTCTTCACAGGG + Intronic
995627092 5:114091709-114091731 AGCAAGGCACCTTCTTCACGAGG + Intergenic
995988525 5:118208518-118208540 AGCAAGGCACCTTCTTTACAAGG - Intergenic
995988838 5:118210803-118210825 AGCAAGGCACCTTCTTCACAAGG - Intergenic
996184645 5:120461062-120461084 AGCAAGGCACCTTCTTCACAAGG - Intergenic
996197083 5:120621742-120621764 AGCAAGGCACCTTCTTTACAAGG - Intronic
996435140 5:123425610-123425632 AGCAAGGCACCTTCCTCACAAGG - Intergenic
996627499 5:125587287-125587309 AGCAAGGCACCATCTTCACAAGG + Intergenic
996663947 5:126035985-126036007 AGCAAGACATCTTCTTCACAAGG + Intergenic
996857932 5:128030814-128030836 AGCAAGGTACCTTCTTCACAAGG - Intergenic
997007555 5:129836490-129836512 AGCAAGGCACCTTCTTCACAGGG + Intergenic
997168654 5:131690549-131690571 AGCAAGGCACCTTCTTCACAAGG - Intronic
997342782 5:133158707-133158729 AGCAAGGCACCTTCTTCACAAGG - Intergenic
997454326 5:134005882-134005904 AACCCGGCACCTCCTCCACAGGG - Intergenic
998983267 5:147727473-147727495 AGCAAGGAACCTTCTTCACATGG + Intronic
999082923 5:148861230-148861252 AGCAAGGCACTTTCTTCACAAGG + Intergenic
999418038 5:151416976-151416998 AGCAAGGCACCTTCTCCACAAGG - Intergenic
999960802 5:156753666-156753688 AGCAAGGAACCTTCTTCACAAGG + Intronic
1000515853 5:162235938-162235960 AGTAAGGCACCTTCTTCACAAGG + Intergenic
1000560121 5:162776928-162776950 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1000686393 5:164254959-164254981 AGCAAGGCACTTCCTTTACAAGG - Intergenic
1001778982 5:174351312-174351334 AGCAAGGCACCTTCTTCACCAGG + Intergenic
1001889242 5:175325219-175325241 AGCAATGCACCTTCTTCACAAGG - Intergenic
1001918442 5:175581460-175581482 AGCAAGGAACCTTCTTCACATGG + Intergenic
1002731945 5:181343212-181343234 AGCAAGCCAGCTTCTTCGCAAGG - Intergenic
1002752586 6:130892-130914 AGCAAGCCAGCTTCTTCGCAAGG + Intergenic
1002958081 6:1888355-1888377 AGCAAGGCACCTTCTTCATAAGG + Intronic
1003402879 6:5805417-5805439 AGCAGGGCACCTTCTTCACAAGG - Intergenic
1003718293 6:8672019-8672041 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1003800828 6:9664993-9665015 AGCAAGGCACCTTCTTCACAAGG - Intronic
1004830628 6:19473703-19473725 AGCAAGGTACCTTCTTCACAAGG - Intergenic
1007003425 6:38336446-38336468 AGAAAGGCACCTTCTTCACATGG + Intronic
1007266731 6:40601963-40601985 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1007529066 6:42524602-42524624 AGCAAGGCACTTTCTTCACAAGG + Intergenic
1007898885 6:45391679-45391701 AGCAAGGCGCCTTCTTCACAAGG + Intronic
1007917969 6:45578627-45578649 GGGAAAGCAGCTCCTCCACATGG - Intronic
1007941082 6:45782235-45782257 TGCCCAGCAGCTCCTCCACAAGG - Intergenic
1007989468 6:46240024-46240046 AGTAAAGGGGCTCCTCCACATGG + Intronic
1008020084 6:46566413-46566435 AGGAAGGCACCTTCTTCACAAGG + Intronic
1008191278 6:48461517-48461539 AGCAAGGCACCTTCTTCACAGGG + Intergenic
1008485996 6:52036432-52036454 TCAAAGGCTGCTCCTCCACATGG - Intronic
1009391292 6:63146713-63146735 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1009415825 6:63415452-63415474 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1009550948 6:65090319-65090341 AGCAAGGCACCTTCTTCACAAGG - Intronic
1009648622 6:66443741-66443763 AGCAAGGCAGCTTCTTCACAAGG - Intergenic
1009710366 6:67309582-67309604 AGCAAGGCATTTTCTTCACAAGG - Intergenic
1009714995 6:67379856-67379878 AGCAAGGCACCTTCTTCATAGGG + Intergenic
1009822740 6:68825764-68825786 AGCAAGGCACTTTCTTCACAAGG - Intronic
1010003088 6:70967984-70968006 AGCAAGGCACCTTTTTCACAAGG + Intergenic
1010024586 6:71200835-71200857 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1010046959 6:71456377-71456399 AGGAAGGCATCTTCTTCACAAGG + Intergenic
1010331073 6:74624371-74624393 AGCAAGGCAACTTCTTCACAAGG - Intergenic
1010472404 6:76244281-76244303 AACAAGGCACCTTCTTCACAAGG - Intergenic
1010524263 6:76881009-76881031 TGCACGGCAGCTTCTTCACATGG + Intergenic
1010726631 6:79342487-79342509 AGCAAGGCACCTTTTTCACAAGG + Intergenic
1010956376 6:82095270-82095292 AGCAAGGCAGTTTCTTCACAAGG + Intergenic
1011004641 6:82630271-82630293 AGCAAGGCGCCTTCTTCACAAGG + Intergenic
1011200901 6:84835010-84835032 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1011385902 6:86797534-86797556 AGCAAGGAACCTTCTTCACAAGG + Intergenic
1011410708 6:87063091-87063113 AGCAAGGCATCATCTTCACAAGG + Intergenic
1011625148 6:89277252-89277274 AGCAAGGCACCTTCTTCACAAGG - Intronic
1011792593 6:90914673-90914695 AGCAAGGCACCTTCTTCACGAGG - Intergenic
1011956528 6:93030868-93030890 AGCAAGACACCTTCTTCACAAGG + Intergenic
1012038209 6:94170127-94170149 TGCAAGGCACCTTCTTCACAAGG + Intergenic
1012107552 6:95183017-95183039 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1012161023 6:95886201-95886223 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1012188790 6:96255154-96255176 AGAAAGGCAGCTTCTTCACAGGG + Intergenic
1012256691 6:97040876-97040898 AGCAAGGCACCTTTTTCACAAGG - Intronic
1012541436 6:100366440-100366462 AGCAAGGCACCTTCCTCACAAGG - Intergenic
1012726999 6:102826064-102826086 AGCAAGGTACCTTCTTCACAAGG - Intergenic
1013402452 6:109812136-109812158 AGCAAGGCACCTTCTTCACAAGG - Intronic
1013701064 6:112770122-112770144 AGTAAGGCACCTTCTTCACAAGG - Intergenic
1013787236 6:113795501-113795523 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1013804991 6:113986770-113986792 AGCAAGGCACCTTCTTCACAAGG - Intronic
1013915998 6:115337282-115337304 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1014169718 6:118265543-118265565 AGCAGTGGAGCTCCTCCAGAAGG + Intronic
1014356720 6:120420791-120420813 AGCAAGGTACCTTCTTCACAAGG + Intergenic
1014581121 6:123138244-123138266 AGCAAGGTACCTTCTTCACAAGG - Intergenic
1014664376 6:124218966-124218988 AGCAAGGCACCTTCTTCACAAGG + Intronic
1015354366 6:132259579-132259601 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1015364267 6:132379458-132379480 AGCAAGGCACATTCTCCACGTGG + Intronic
1015456993 6:133437708-133437730 AGCAAGGCACCTTCTTCCCAAGG + Intronic
1015459841 6:133477049-133477071 AGCAAGGCACCTTCTTCACAAGG - Intronic
1015828744 6:137344795-137344817 ATCAAGGCAGCTCAGGCACAGGG + Intergenic
1016148503 6:140706205-140706227 TGCAAGGCACCTTCTTCACAAGG - Intergenic
1016487982 6:144564627-144564649 AGCAAGGCACCTTCTTCACAAGG + Intronic
1016599693 6:145844124-145844146 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1016727721 6:147394720-147394742 AGCAAGGCACTTTCTTCACAAGG + Intergenic
1016728468 6:147401981-147402003 AGCAAGGCACCTTCTTCACTAGG + Intergenic
1016901028 6:149102434-149102456 AGAAAGGCACCTTCTTCACAAGG + Intergenic
1016980759 6:149851926-149851948 AGCAAGGCACCTTCTTCACAAGG + Intronic
1017429871 6:154360585-154360607 AGCAAGGCGCCTTCTTCACAAGG + Intronic
1017794972 6:157835735-157835757 AGCAAGGCACCTTCTTCACAAGG - Intronic
1017927943 6:158926326-158926348 AGCAGGGCACCTTCTTCACAAGG - Intergenic
1018355014 6:163004438-163004460 AGCAAGACACCTTCTTCACAAGG + Intronic
1018564668 6:165138606-165138628 AGCAAGGCATCTTCTTCACAAGG - Intergenic
1018680086 6:166257373-166257395 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1018965712 6:168487181-168487203 GGCAAAGCTGCACCTCCACAGGG + Intronic
1019113665 6:169738803-169738825 AGCAACGCACCTTCTTCACAAGG + Intergenic
1019123863 6:169826033-169826055 ATGAAGGCAGCTCCTCGAGAGGG - Intergenic
1019236196 6:170615529-170615551 AGCAAGCCAGCTTCTTCGCAAGG - Intergenic
1019588795 7:1818735-1818757 AGCAAGACAGCTGCTCCCAATGG + Intronic
1020565870 7:9794827-9794849 AGCAAGGCACCTTCTCCATAAGG + Intergenic
1020680981 7:11235826-11235848 AGCAAGGCACTTTCTTCACAAGG - Intergenic
1021056620 7:16056157-16056179 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1021357011 7:19662368-19662390 AGCAAGGAACTTCCTCAACATGG + Intergenic
1022352442 7:29578497-29578519 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1022392759 7:29957863-29957885 ATCATGGCAGCTCCCCCACATGG - Intronic
1022694728 7:32692982-32693004 AGCAAGCCACCTTCTTCACAAGG - Intergenic
1022818961 7:33939707-33939729 AGCAAGGCACCTTCTTCACAAGG - Intronic
1022927913 7:35074482-35074504 AGCAAGCCACCTTCTTCACAAGG - Intergenic
1022947490 7:35301983-35302005 AGCAAGACACCTTCTTCACAAGG - Intergenic
1022976137 7:35558473-35558495 AGCAAGGCACTTTCTTCACAAGG - Intergenic
1023236734 7:38098181-38098203 AGCAAAGCACCTTCTTCACAAGG - Intergenic
1023793615 7:43772688-43772710 AGCAAGGCACCTTCTTCACAAGG + Intronic
1026067226 7:67085433-67085455 AGCAAGGCACCTCCTTCACAAGG - Intronic
1026096554 7:67351245-67351267 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1026709703 7:72726895-72726917 AGCAAGGCACCTCCTTCACAAGG + Intronic
1027375675 7:77546797-77546819 AGCAAGGCACCTTCTTCACAAGG + Intronic
1027507824 7:79040233-79040255 AGCATGGCACCTTCTTCACAAGG - Intronic
1027697699 7:81432165-81432187 AGCAAGACACCTTCTGCACAAGG - Intergenic
1027723139 7:81769997-81770019 ACCCAGGCATCTCCTCCAGAGGG - Exonic
1027728707 7:81841554-81841576 AGCAAGGCACATTCTTCACAAGG - Intergenic
1027729266 7:81849295-81849317 AGCAAGGTACCTTCTTCACAAGG + Intergenic
1030401036 7:109050206-109050228 AGCAAGGCACCTTCTTCACAGGG - Intergenic
1030611366 7:111693158-111693180 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1030703980 7:112672120-112672142 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1030785276 7:113652870-113652892 CGCAAGGCACCTTCTTCACAAGG + Intergenic
1030916342 7:115318602-115318624 AGGAAGGCACCTTCTTCACAAGG - Intergenic
1031172360 7:118308216-118308238 AGCAAGGCACCTTCTTCATAAGG + Intergenic
1031358267 7:120815514-120815536 AGCAAGACACCTTCTTCACATGG - Intronic
1031567832 7:123321749-123321771 AGCAAGGCAACTTCTTCGCAAGG + Intergenic
1031637442 7:124118981-124119003 AGCAAGGCACCTTCTTCTCAAGG - Intergenic
1031637693 7:124120873-124120895 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1031755587 7:125637918-125637940 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1031760313 7:125705734-125705756 TGCAAGGCATCTTCTTCACAAGG - Intergenic
1031785357 7:126024203-126024225 AGCAAGGCATCTTTTTCACAAGG - Intergenic
1032488601 7:132307014-132307036 AACTAGGCAGCTCTTCCACAAGG - Intronic
1032633931 7:133685371-133685393 AGCAAGGCACCTTCTTCACAAGG - Intronic
1032636391 7:133713776-133713798 AGCAAGGCACCTTCTTCACAAGG - Intronic
1032759351 7:134924930-134924952 AGCAAGGCACCTTCTTCACTAGG - Intronic
1032894615 7:136236693-136236715 AGCATGGCACCTTCTTCACAAGG + Intergenic
1033221087 7:139526431-139526453 AGCAGGGCTGCTCCTCTCCAGGG + Intronic
1033777853 7:144632918-144632940 AACAAGGCACCTTCTACACAGGG + Intronic
1033804136 7:144935731-144935753 AGCAAGGCACCCTCTTCACAGGG - Intergenic
1033901755 7:146151008-146151030 AGCAAGGCACCTTCATCACAAGG + Intronic
1033908704 7:146238803-146238825 GGCAAGGCACCTTCTTCACAAGG + Intronic
1034470280 7:151251194-151251216 AGCTCACCAGCTCCTCCACAGGG - Intronic
1035078102 7:156194264-156194286 GGCAAGGCAGCTCCTTCATTGGG + Intergenic
1035511574 8:191072-191094 AGCAAGCCAGCTTCTTCGCAAGG + Intergenic
1035686767 8:1529176-1529198 AGCAAGGCACCTACTTCACAAGG + Intronic
1035746950 8:1967994-1968016 AGCGAGGCAGGACCTCCGCAAGG - Intergenic
1035785487 8:2256700-2256722 AGCCTAGAAGCTCCTCCACATGG - Intergenic
1035807321 8:2465016-2465038 AGCCTAGAAGCTCCTCCACATGG + Intergenic
1035918270 8:3649522-3649544 AGCAAGGCACCTTCTTCACAAGG + Intronic
1036527189 8:9546338-9546360 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1037085959 8:14850855-14850877 AGCAAGGCATCTTCTTCAGAAGG - Intronic
1037151691 8:15643140-15643162 AGCAAGGCACCTTCTTCACAAGG - Intronic
1037534064 8:19808655-19808677 AGCAAGGCACCCTCTTCACAGGG + Intergenic
1037635595 8:20698977-20698999 AGCAAGGCAGCTTCTTCACAAGG + Intergenic
1037886319 8:22598275-22598297 AAGAAGGCACCTCCTCCAGAGGG - Intronic
1038042816 8:23740250-23740272 AGCAAGCAATCTCCTTCACAAGG - Intergenic
1038073492 8:24045170-24045192 AACAAGGCACCTTCTTCACAAGG - Intergenic
1038496136 8:28004304-28004326 AGCAAGGCAACTTCTTCACAAGG - Intergenic
1038713647 8:29972481-29972503 AGCAAGGCACTTCCTTCACAAGG + Intergenic
1039098501 8:33913843-33913865 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1039150282 8:34497054-34497076 AGCAAGTCACCTTCTTCACAGGG + Intergenic
1039195346 8:35024866-35024888 AGCAGGGCAGCTGCTGCTCAAGG - Intergenic
1039220169 8:35321479-35321501 AGCAAGACACCTCCTCCACAAGG - Intronic
1039272909 8:35902624-35902646 AGCAAGGAAACTTCTTCACAAGG - Intergenic
1039644849 8:39269934-39269956 AGCAAGGCACCTTCTTCACAAGG + Intronic
1040456580 8:47604373-47604395 AACACTGCAGCTCCTGCACATGG - Intronic
1040605428 8:48927082-48927104 AGCAAGGCAGGCACACCACATGG - Intergenic
1040733064 8:50473262-50473284 AGCAAGGCATCTTCTTCATAAGG - Intronic
1040890971 8:52315378-52315400 ACCAAGGCAGCAGATCCACATGG + Intronic
1041445002 8:57941598-57941620 AGCAGGGCAGCCCCTCAGCAGGG + Intergenic
1041976964 8:63810577-63810599 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1042204131 8:66311349-66311371 AGTAAGGCACCTTCTTCACAAGG + Intergenic
1042266225 8:66911334-66911356 AGCAAGGCACCTTCTTCACAGGG - Intronic
1042604041 8:70528364-70528386 AGCAGGGAAGCTCCTGCCCATGG + Intergenic
1042631372 8:70820679-70820701 AGCAAGGCAACTTCTTCACAAGG + Intergenic
1042651032 8:71041780-71041802 AGCAAGGAAACTTCTTCACATGG - Intergenic
1042754875 8:72200183-72200205 AGCAAGGCGCCTTCTTCACAAGG - Intergenic
1043073431 8:75666032-75666054 AGCAAGGTACCTTCTTCACATGG - Intergenic
1043143789 8:76625170-76625192 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1043240569 8:77928895-77928917 AGAAAGGCACCTTCTTCACAAGG + Intergenic
1043266657 8:78274573-78274595 AGCAAGGTACCTTCTTCACAAGG - Intergenic
1043625234 8:82248881-82248903 AGCCAGGCACCTGCTTCACAAGG - Intergenic
1043644224 8:82497847-82497869 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1044056074 8:87570666-87570688 TGCAAGGCACCTTCTTCACAAGG - Intronic
1044066698 8:87707327-87707349 AGCAAGGCACCTTCATCACAAGG + Intergenic
1044086983 8:87954335-87954357 AACAAGGCACCTCCTTCACAAGG - Intergenic
1044186274 8:89255396-89255418 AGCAAGGCACCTTCTTTACAAGG + Intergenic
1044562106 8:93622563-93622585 AGCAAGGCACCTTCTTCATAAGG - Intergenic
1044773659 8:95664642-95664664 AGCAAGGCACTTTCTTCACAAGG + Intergenic
1045525266 8:102936073-102936095 TGCAAGACAGCTCCTTCACGGGG - Intronic
1045672482 8:104571556-104571578 AGTAAGGCACCTTCTTCACAAGG - Intronic
1045849157 8:106672841-106672863 AGCAAGGCACCTTCTTTACAAGG - Intronic
1046061814 8:109149332-109149354 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1046169110 8:110482083-110482105 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1046264428 8:111813329-111813351 AGAAAGGCACCTTCTTCACAGGG + Intergenic
1046331811 8:112726031-112726053 AGCAAGGCACCTTCTTTACAAGG + Intronic
1046430120 8:114113623-114113645 AGCAAGGTACCTTCTTCACAAGG - Intergenic
1046457606 8:114487275-114487297 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1046517458 8:115281966-115281988 AGAAAGGCACCTTCTTCACATGG + Intergenic
1047017200 8:120736077-120736099 AGCAAGGCACCTTCTTCACAAGG + Intronic
1047033801 8:120913077-120913099 AGCAAGACACCTTCCCCACAGGG - Intergenic
1047151375 8:122267305-122267327 AGCAAGGCACCTTTTTCACAAGG + Intergenic
1047178792 8:122567637-122567659 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1047213717 8:122860110-122860132 AGCAAGGCACCTTCTTCACAAGG + Intronic
1047226751 8:122961608-122961630 AGCAAGGCACCTTCTTCACAAGG + Intronic
1047324703 8:123825085-123825107 AGCAAGACACCTTCTTCACAAGG - Intergenic
1048114586 8:131507416-131507438 AGCAAGGCACCTGCTTCAAAAGG - Intergenic
1048117381 8:131539992-131540014 AGCAAGGTACCTTCTTCACAAGG + Intergenic
1048288305 8:133159869-133159891 AGCAAGGCACCTTCATCACATGG - Intergenic
1048356760 8:133660380-133660402 AGCAAGGCACCTTCTTCATAAGG + Intergenic
1048388216 8:133933597-133933619 AGCAAGGCACCCTCTTCACAAGG + Intergenic
1048532816 8:135265721-135265743 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1048622696 8:136152240-136152262 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1048691668 8:136971918-136971940 AGCAAGGTACCTTCTTCACAAGG - Intergenic
1048695760 8:137026127-137026149 AGCAAGGCACCTTCTTTACAAGG + Intergenic
1048748320 8:137641501-137641523 AGCAAGGCATCTTCTTCACAAGG - Intergenic
1048826974 8:138437476-138437498 AACAAGGCACCTTCTTCACAAGG - Intronic
1048901101 8:139038450-139038472 AGGAAGGCAACTTCTTCACAAGG + Intergenic
1048940552 8:139396837-139396859 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1050903235 9:10971677-10971699 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1051117492 9:13713277-13713299 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1051255308 9:15207052-15207074 AGCAAGGTACCTTCTTCACAAGG - Intronic
1051344082 9:16136961-16136983 AGCCAGGCAGCTGCTTCCCAGGG + Intergenic
1051368080 9:16335402-16335424 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1051430090 9:16972795-16972817 AGCAAGGCACCTTTTTCACAAGG - Intergenic
1051465260 9:17369231-17369253 AGCAAGGCACCTTCTTCACAAGG - Intronic
1051493782 9:17696552-17696574 AGAAAGGCACCTTCTTCACAGGG + Intronic
1051539949 9:18204361-18204383 AGTAAGGCACCTTCTTCACAAGG - Intergenic
1052077832 9:24165930-24165952 AGCAAGGCACCTTCTTCACTAGG - Intergenic
1052178861 9:25500887-25500909 AGCAAGGTACCTTCTTCACAAGG - Intergenic
1052462819 9:28788650-28788672 AGCAAGGCAAATTCTTCACAAGG + Intergenic
1052502082 9:29304840-29304862 AGCAAGGCACCTTCTTCACAGGG + Intergenic
1052511928 9:29433255-29433277 AGCAAGGTAGCTTCTTCACAAGG + Intergenic
1052554326 9:29994475-29994497 AGCAAGGGACCTCCTTCACAAGG + Intergenic
1052665914 9:31495802-31495824 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1052666184 9:31497852-31497874 GGCAAGGCACCTTCTTCACAAGG + Intergenic
1053720843 9:40945513-40945535 ATCAAGGCACCTTCTTCACAAGG + Intergenic
1054802041 9:69359549-69359571 AGCAAGGCAACTTCCTCACAAGG - Intronic
1055171796 9:73267251-73267273 AGCAAGACACCTTCTTCACAAGG - Intergenic
1055225620 9:73990917-73990939 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1055231908 9:74076663-74076685 AGAAAGGCACCTTCTTCACAGGG + Intergenic
1055366952 9:75554949-75554971 AGCAAGGCACCTCCTTCACAGGG + Intergenic
1055542659 9:77328952-77328974 AGCAAGGCACTTTCTTCACAAGG + Intronic
1056441830 9:86629568-86629590 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1057233449 9:93339518-93339540 AGCAAGGCACCTTCTTCACAAGG - Intronic
1057252339 9:93514126-93514148 AGCAAGGCACCTTCTTAACAAGG + Intronic
1058337672 9:103853208-103853230 AGTAAGGCACCTTCTTCACAAGG + Intergenic
1058725152 9:107795884-107795906 AACAAGGCACCTTCTTCACAAGG - Intergenic
1058951457 9:109907650-109907672 AATCAGGAAGCTCCTCCACATGG - Intronic
1059565076 9:115376095-115376117 AGCAAGGCACCTTCTTCACAAGG + Intronic
1059570209 9:115426163-115426185 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1060260086 9:122066863-122066885 AGCAAGGCACCTTCTTCACAAGG + Intronic
1060487736 9:124059893-124059915 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1061651646 9:132055048-132055070 AGCAAGGAAGCAGATCCACAGGG - Intronic
1062214941 9:135384128-135384150 CACAAGCCAGCTCCTCCAGAGGG + Intergenic
1062756347 9:138295547-138295569 AGCAAGCCAGCTTCTTCGCAAGG - Intergenic
1203454303 Un_GL000219v1:150364-150386 ACCAAGGCACCTTCTTCACAAGG - Intergenic
1185848615 X:3464471-3464493 AGCAGGGCACCTTCTTCACAAGG + Intergenic
1186014356 X:5174428-5174450 AGCAAGGCACCTTCTTCATAAGG + Intergenic
1186054571 X:5635277-5635299 AGCAAAGCACCTTCTTCACAAGG - Intergenic
1186145844 X:6622794-6622816 AGCAAGGCACCTTCTTTACAAGG - Intergenic
1186221416 X:7353535-7353557 AGCAAAGCAGCTGCTTCACCAGG - Exonic
1186319651 X:8410601-8410623 AGCAAGGCACCTTCTTTACAAGG + Intergenic
1186327362 X:8494324-8494346 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1187082266 X:16003233-16003255 AGCAAGGCACCTTCTTCGCAAGG - Intergenic
1187566637 X:20456686-20456708 AGCAAGGCACCAACTTCACAAGG - Intergenic
1187574634 X:20541448-20541470 AGCAAGGCACTTTCTTCACAGGG - Intergenic
1187578962 X:20588169-20588191 AGCAAGGCAACTTCTTCACAAGG + Intergenic
1187676278 X:21719684-21719706 AGGAAGGCAGAACCTCTACAGGG - Intronic
1187797890 X:23024401-23024423 AGCAAGGCACCTTTTTCACAAGG + Intergenic
1188018810 X:25134770-25134792 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1188018896 X:25135397-25135419 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1188148029 X:26638507-26638529 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1188343073 X:29029044-29029066 AGCAAGGCACCTTCTTCACAAGG + Intronic
1188606887 X:32042371-32042393 AGCAAGGCACCTCCTTTACAAGG + Intronic
1188616664 X:32165930-32165952 AGCGAGGCACCTTCTTCACAAGG - Intronic
1188802722 X:34551489-34551511 AGCAAGGCGTCTTCTACACAAGG - Intergenic
1189352642 X:40287927-40287949 AGCAAGGCATCTTCTTCGCAAGG + Intergenic
1189730400 X:44014259-44014281 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1189849221 X:45162450-45162472 ATGGAGGCAGCTCCTCCCCAAGG + Intronic
1189957016 X:46286423-46286445 AGAAAGGCACCTTCTTCACAGGG - Intergenic
1190097619 X:47494408-47494430 AGCAAGGCACCTTCCTCACAAGG + Intergenic
1190334300 X:49253100-49253122 AGCAGGGCAGCTCGGCCCCAAGG - Intronic
1191643653 X:63454839-63454861 AGCAAGGTACCTTCTTCACAAGG + Intergenic
1191820259 X:65298854-65298876 AGCAAGGCACCATCTTCACAAGG + Intergenic
1192378469 X:70588472-70588494 AGCAAGGCACCTTCTTCACAAGG - Intronic
1192546842 X:72021443-72021465 AGAAAGGGAGCTTCTCCTCAGGG + Intergenic
1193534656 X:82698985-82699007 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1193617256 X:83704611-83704633 AGCAATGCACCTTCTTCACAAGG + Intergenic
1193655383 X:84190569-84190591 AGCAAGGTACCTTCTTCACATGG - Intergenic
1193822208 X:86179715-86179737 AGCAAGCCAGCTCCTTCATTGGG - Intronic
1193889458 X:87026904-87026926 AGCAAGGCACCTTCTTTACAAGG + Intergenic
1193985767 X:88238489-88238511 AGCAAGGCACCTTCTTCGCAAGG - Intergenic
1193998700 X:88400062-88400084 AGAAAGGCATCTTCTTCACAAGG + Intergenic
1194132162 X:90094765-90094787 AGCAAAGCACCTTCTTCACAAGG - Intergenic
1194144236 X:90244000-90244022 AGCAAGGCACCATCTTCACAAGG + Intergenic
1194359990 X:92938140-92938162 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1194447341 X:94004800-94004822 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1194489080 X:94525017-94525039 AGCAAGGCAGCCTCTCCTCAGGG - Intergenic
1194518201 X:94885357-94885379 AGCAATGCACCTTCTACACAAGG + Intergenic
1194554082 X:95336666-95336688 AGCAAGGCATCTTCTCCACAGGG + Intergenic
1194633145 X:96311503-96311525 AGCAAGACACCTTCTTCACAGGG + Intergenic
1194646645 X:96465821-96465843 AGCAAGGCGCCTTCTTCACAAGG + Intergenic
1194691769 X:96994717-96994739 AGCAAGGCACCTTCTTCACAAGG + Intronic
1194740036 X:97561679-97561701 GGCAAGGCAGATCCTCAAGATGG - Intronic
1194779705 X:98009956-98009978 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1194779978 X:98011844-98011866 AGCAAGTCACCTTCTTCACAAGG - Intergenic
1194893052 X:99404443-99404465 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1195242972 X:102971548-102971570 AGCAAGGCACCTTCCTCACAAGG - Intergenic
1195460467 X:105117686-105117708 AGAAAGGCACCTTCTTCACAGGG - Intronic
1195885815 X:109636316-109636338 AGCAAGGCACCTTCTCCACAAGG - Intronic
1196135184 X:112201106-112201128 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1196306434 X:114108417-114108439 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1196366275 X:114927724-114927746 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1196573461 X:117290279-117290301 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1196820776 X:119698571-119698593 AGCAAGGCACCTTCTTTACAAGG - Intergenic
1196864906 X:120061910-120061932 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1196878195 X:120174422-120174444 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1196929779 X:120669905-120669927 AACAAGGCACCTTCTTCACAAGG - Intergenic
1196949697 X:120864863-120864885 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1196996170 X:121386750-121386772 AGCAAGACACCTTCTTCACAAGG - Intergenic
1197545142 X:127815450-127815472 AGCAATCCACCTCCTTCACAGGG - Intergenic
1197582712 X:128304251-128304273 AGCAAGGCACCTTCTTCACCAGG - Intergenic
1197665280 X:129216617-129216639 AGAAAGGCACCTTCTTCACAGGG + Intergenic
1197953444 X:131921981-131922003 AGTAAGGCACCTTCTTCACAAGG - Intergenic
1198017432 X:132625359-132625381 AGCAAGGCATCTTCTTCACAAGG - Intergenic
1198258674 X:134947223-134947245 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1198693428 X:139308522-139308544 AGCAAGGCACCTACTTCACATGG - Intergenic
1198847227 X:140925027-140925049 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1199034851 X:143037837-143037859 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1199041322 X:143118648-143118670 AGCAAGGCATCTTCTTCACAAGG + Intergenic
1199041580 X:143120585-143120607 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1199051618 X:143242942-143242964 AGCAAGTCACCTTCTTCACAAGG + Intergenic
1199061698 X:143363320-143363342 AGAAAGGCACCTTCTTCACAAGG - Intergenic
1199178959 X:144829401-144829423 AGCAAGGCAGCTTCCTCAGAAGG - Intergenic
1199462802 X:148102208-148102230 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1199829078 X:151531080-151531102 AGCAAGGCACCTTCTTCACAAGG + Intergenic
1200123859 X:153804098-153804120 GCCAAGGCAGCTCCTCCACCGGG - Exonic
1200295191 X:154912830-154912852 AGCAAGGCACCTTTTTCACAAGG + Intronic
1200295511 X:154915072-154915094 AGCAAGGCATCTTCTTCACAAGG + Intronic
1200490000 Y:3813308-3813330 AGCAAGGCACCATCTTCACAAGG + Intergenic
1200668191 Y:6053961-6053983 AGCAAGGCAACTTCTTCACAAGG + Intergenic
1201227566 Y:11833059-11833081 AGCAAGGTAGCTTCTTCACAGGG + Intergenic
1201434643 Y:13943754-13943776 AGCAAGGCACCTTCTTCACAAGG - Intergenic
1201504343 Y:14681281-14681303 AGAAAGGCACCTTCTTCACAAGG + Intronic
1201589605 Y:15600550-15600572 AGCAAAGCAGCTGCTTCACCAGG - Intergenic