ID: 1122735137

View in Genome Browser
Species Human (GRCh38)
Location 14:103834672-103834694
Sequence CACTTGCACCCGGAGGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49167
Summary {0: 1, 1: 3, 2: 287, 3: 6927, 4: 41949}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122735137_1122735144 8 Left 1122735137 14:103834672-103834694 CCTCCGCCCTCCGGGTGCAAGTG 0: 1
1: 3
2: 287
3: 6927
4: 41949
Right 1122735144 14:103834703-103834725 CCCTCAGCCTCCTGAGTAACTGG 0: 46
1: 4104
2: 109949
3: 215584
4: 243501
1122735137_1122735148 17 Left 1122735137 14:103834672-103834694 CCTCCGCCCTCCGGGTGCAAGTG 0: 1
1: 3
2: 287
3: 6927
4: 41949
Right 1122735148 14:103834712-103834734 TCCTGAGTAACTGGGATTACAGG 0: 1532
1: 59113
2: 147804
3: 232976
4: 201000
1122735137_1122735146 9 Left 1122735137 14:103834672-103834694 CCTCCGCCCTCCGGGTGCAAGTG 0: 1
1: 3
2: 287
3: 6927
4: 41949
Right 1122735146 14:103834704-103834726 CCTCAGCCTCCTGAGTAACTGGG 0: 2930
1: 105244
2: 210342
3: 240613
4: 149234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122735137 Original CRISPR CACTTGCACCCGGAGGGCGG AGG (reversed) Intronic
Too many off-targets to display for this crispr