ID: 1122735681

View in Genome Browser
Species Human (GRCh38)
Location 14:103839368-103839390
Sequence TGTTAACCCCAGCACTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5515
Summary {0: 1, 1: 8, 2: 45, 3: 399, 4: 5062}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122735676_1122735681 -2 Left 1122735676 14:103839347-103839369 CCGGGCACAGTGGCTCACGCCTG 0: 7488
1: 42205
2: 102868
3: 132676
4: 135912
Right 1122735681 14:103839368-103839390 TGTTAACCCCAGCACTTTGGGGG 0: 1
1: 8
2: 45
3: 399
4: 5062

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122735681 Original CRISPR TGTTAACCCCAGCACTTTGG GGG Intronic
Too many off-targets to display for this crispr