ID: 1122737160

View in Genome Browser
Species Human (GRCh38)
Location 14:103849402-103849424
Sequence CATTTGGATCACCTTACCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122737160_1122737163 -7 Left 1122737160 14:103849402-103849424 CCCGGGGTAAGGTGATCCAAATG No data
Right 1122737163 14:103849418-103849440 CCAAATGAGCCTGCTCTTCCAGG No data
1122737160_1122737165 -2 Left 1122737160 14:103849402-103849424 CCCGGGGTAAGGTGATCCAAATG No data
Right 1122737165 14:103849423-103849445 TGAGCCTGCTCTTCCAGGAAGGG No data
1122737160_1122737167 7 Left 1122737160 14:103849402-103849424 CCCGGGGTAAGGTGATCCAAATG No data
Right 1122737167 14:103849432-103849454 TCTTCCAGGAAGGGAAGCATTGG No data
1122737160_1122737169 14 Left 1122737160 14:103849402-103849424 CCCGGGGTAAGGTGATCCAAATG No data
Right 1122737169 14:103849439-103849461 GGAAGGGAAGCATTGGCACAAGG No data
1122737160_1122737164 -3 Left 1122737160 14:103849402-103849424 CCCGGGGTAAGGTGATCCAAATG No data
Right 1122737164 14:103849422-103849444 ATGAGCCTGCTCTTCCAGGAAGG No data
1122737160_1122737170 15 Left 1122737160 14:103849402-103849424 CCCGGGGTAAGGTGATCCAAATG No data
Right 1122737170 14:103849440-103849462 GAAGGGAAGCATTGGCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122737160 Original CRISPR CATTTGGATCACCTTACCCC GGG (reversed) Intergenic
No off target data available for this crispr