ID: 1122738369

View in Genome Browser
Species Human (GRCh38)
Location 14:103856605-103856627
Sequence TTCCCTCTGGATGTTGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122738366_1122738369 -5 Left 1122738366 14:103856587-103856609 CCCTGCACACAGCGAGCTTTCCC 0: 1
1: 0
2: 1
3: 17
4: 150
Right 1122738369 14:103856605-103856627 TTCCCTCTGGATGTTGTGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 197
1122738363_1122738369 20 Left 1122738363 14:103856562-103856584 CCCGAAGGAGGGTAGGAGTCTTG 0: 1
1: 0
2: 1
3: 9
4: 149
Right 1122738369 14:103856605-103856627 TTCCCTCTGGATGTTGTGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 197
1122738367_1122738369 -6 Left 1122738367 14:103856588-103856610 CCTGCACACAGCGAGCTTTCCCT 0: 1
1: 0
2: 2
3: 26
4: 148
Right 1122738369 14:103856605-103856627 TTCCCTCTGGATGTTGTGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 197
1122738364_1122738369 19 Left 1122738364 14:103856563-103856585 CCGAAGGAGGGTAGGAGTCTTGG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1122738369 14:103856605-103856627 TTCCCTCTGGATGTTGTGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 197
1122738361_1122738369 30 Left 1122738361 14:103856552-103856574 CCGTGCTAGGCCCGAAGGAGGGT 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1122738369 14:103856605-103856627 TTCCCTCTGGATGTTGTGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122738369 Original CRISPR TTCCCTCTGGATGTTGTGTC AGG Intergenic
900531840 1:3157753-3157775 GTCCATCTGGGTGTTGTCTCTGG - Intronic
901508213 1:9700006-9700028 TTTCCTTTGGATGGTGGGTCAGG - Intronic
902285480 1:15405723-15405745 TTCCCCCAGGAGGTTGTGTTGGG + Intergenic
902393658 1:16120455-16120477 TAACCCCTGGCTGTTGTGTCAGG - Intergenic
903086525 1:20864703-20864725 TCTCCTCTGGCTGTTGTGTAAGG + Exonic
903772485 1:25772649-25772671 TGCCCTCTGAATGCTGTGTGGGG + Intronic
904484347 1:30814918-30814940 CTCCCTCTGGATGCTGTATGGGG - Intergenic
906951547 1:50338137-50338159 TTCACTCTTGGTGTTGTCTCTGG + Intergenic
907750124 1:57255133-57255155 TTCCCTCTGAAAACTGTGTCAGG + Intronic
911203515 1:95070122-95070144 TTCCTTCTGGATGTGGGGTAGGG - Intronic
914901400 1:151713102-151713124 TTCCTACTGGAAGCTGTGTCAGG + Intronic
917306581 1:173631416-173631438 TTCTGTCTGGATGATCTGTCCGG - Intronic
918110690 1:181452807-181452829 TTCCCTCTGGATCTTGTTCTAGG + Intronic
922730047 1:227945023-227945045 GACCCTCTGGATGTGGAGTCAGG - Intronic
922794857 1:228334982-228335004 TTCCCTCGGGATGATGTGAGTGG - Intronic
1068328121 10:55522363-55522385 TTCCCTATTGATTTTCTGTCTGG + Intronic
1069612960 10:69787573-69787595 TGCCCTGTGGATGAAGTGTCTGG + Intergenic
1070640368 10:78164516-78164538 TGAGCTCTGGATGTTGTGTCTGG - Intergenic
1072269671 10:93763898-93763920 TTCCCTCTGGATGTCCGGTCAGG - Intronic
1072527497 10:96286627-96286649 TTCCCTCTGGCTTTGGTGTTTGG - Intergenic
1073611277 10:104946410-104946432 TTCTCTCTGCATGCTGTGTGTGG + Intronic
1075395522 10:122124248-122124270 TTCCCTCTGCACCTAGTGTCAGG + Intronic
1075909400 10:126111020-126111042 TTCCCTCAGGATTATGTGACTGG - Intronic
1076617078 10:131762090-131762112 TTCCTTGTGTATGTTGTGTGGGG - Intergenic
1077930072 11:6721667-6721689 TCTCCCATGGATGTTGTGTCTGG + Intergenic
1079977011 11:27104455-27104477 TTCACTCTAGATGTTGTATAGGG + Intronic
1081209995 11:40321196-40321218 TTCCCTCTGGAAGATATGTGAGG - Intronic
1082767620 11:57181627-57181649 TTTCCTCTTGGTGCTGTGTCTGG - Intergenic
1083078814 11:60069523-60069545 TTACCTCTGGATGTTGCCACTGG + Intronic
1088889666 11:114034756-114034778 CTGCCTCTGGATGTTGCCTCTGG + Intergenic
1088983629 11:114886887-114886909 TTCCCTCTGGAGGAGGTGTCAGG - Intergenic
1094432871 12:30389046-30389068 TTCCCTTTGGGACTTGTGTCTGG - Intergenic
1094759008 12:33507203-33507225 TTCCTTATTGATTTTGTGTCTGG - Intergenic
1097227033 12:57483441-57483463 GTCACTCTGGCTGCTGTGTCAGG - Intronic
1098511745 12:71323015-71323037 TTCCCTATTGATTTTCTGTCTGG - Intronic
1098929215 12:76391218-76391240 TTCTCTCTGGATTTTGGCTCAGG - Intronic
1098958565 12:76714038-76714060 TTCCTTCTGGAAGTTCTATCTGG + Intergenic
1101783965 12:107865386-107865408 TTCACTCATGATTTTGTGTCTGG - Intergenic
1102343818 12:112145075-112145097 TTTCCTGAGGATGTTGTGTCTGG + Intronic
1103978507 12:124720254-124720276 TTCCCTCTGGCTGCCGTGTGAGG + Intergenic
1106356802 13:28991024-28991046 TTCCCTCTTGCTCTTGTGTCCGG - Intronic
1108074900 13:46669879-46669901 TTCCATCCTGATCTTGTGTCAGG + Intronic
1109220150 13:59633400-59633422 TTCACTCCGGATGCTGAGTCAGG - Intergenic
1113914324 13:113861791-113861813 TTCCCTCTGGTTTTTGGATCTGG - Intronic
1113942836 13:114027277-114027299 TTCCCTCTGGAAGTTCCTTCCGG - Intronic
1114173285 14:20295889-20295911 TTCCCTCGGGATAGTTTGTCTGG - Intronic
1114218561 14:20676529-20676551 TTCCTACAGGATGTTGTCTCTGG - Intergenic
1114914479 14:27245862-27245884 TTCCCTACAGATGTTGTGACAGG - Intergenic
1116267805 14:42718009-42718031 TTCCCTCTGGTTCTTGCTTCTGG + Intergenic
1117102459 14:52364376-52364398 TTCCCTCTGGATTTTGAGTCTGG - Intergenic
1117535474 14:56698740-56698762 TTCCCTCTGGATTTTAGGTCTGG - Intronic
1118798019 14:69162140-69162162 TTCTCTGTTGATGTTCTGTCTGG - Intergenic
1119052052 14:71378939-71378961 TTGCCTCTGGATGATCTGTTTGG + Intronic
1121369524 14:93344474-93344496 TTCCCTCTGGTTCTTATCTCTGG + Intronic
1121738195 14:96233485-96233507 TTTCCTCTGGCTGTGGAGTCTGG + Intronic
1122190583 14:100039740-100039762 TTCTCTCTGGCTTGTGTGTCTGG + Intronic
1122738369 14:103856605-103856627 TTCCCTCTGGATGTTGTGTCAGG + Intergenic
1123202995 14:106684601-106684623 CTTCCTCTGGATGGTCTGTCTGG + Intergenic
1123981093 15:25604467-25604489 TTCCTTCTTGATTTTCTGTCTGG + Intergenic
1125162047 15:36655758-36655780 TTCTTTCTAGATGCTGTGTCTGG - Intronic
1125856039 15:42950694-42950716 TCCCCTCTCCAGGTTGTGTCAGG - Intronic
1125905138 15:43384785-43384807 ATCACTCTGGATGCTGTGTGGGG + Intronic
1126940646 15:53761714-53761736 GTTCCTCTGGAGGTTGAGTCAGG + Intronic
1127282966 15:57507690-57507712 TCACCTCTGGATGCTGTGGCAGG + Intronic
1128270248 15:66303093-66303115 TTCACTCTGCATAATGTGTCAGG + Intronic
1128917984 15:71583949-71583971 TTCCTTATGGATTTTCTGTCTGG + Intronic
1129886138 15:79038698-79038720 TTGCCTGTTGATTTTGTGTCTGG + Intronic
1130801413 15:87267403-87267425 ATCCTTCTGGATGCTATGTCTGG - Intergenic
1131975124 15:97936733-97936755 ACTCCTCTGGATTTTGTGTCTGG - Intergenic
1132128577 15:99252425-99252447 TTCCTTCTGAATGTTCTGGCTGG - Intronic
1134088850 16:11378927-11378949 TTCCTTCTTGATCTTCTGTCTGG + Intronic
1134093826 16:11405764-11405786 ATCCCTCTGGCTGCTGTGTGGGG - Intronic
1136568157 16:31082019-31082041 TACCCCCTGGCTGCTGTGTCTGG + Intronic
1136738425 16:32486900-32486922 TTCCTTCTAGTTTTTGTGTCTGG - Intergenic
1138905740 16:61329853-61329875 TTCCTTATTGATGTTATGTCTGG + Intergenic
1203014789 16_KI270728v1_random:344892-344914 TTCCTTCTAGTTTTTGTGTCTGG + Intergenic
1203033124 16_KI270728v1_random:618051-618073 TTCCTTCTAGTTTTTGTGTCTGG + Intergenic
1144351218 17:14398710-14398732 ATCTATCTGGATTTTGTGTCTGG - Intergenic
1145395907 17:22494783-22494805 TTCCCTTTGGAAGTTGGGCCTGG - Intergenic
1145823229 17:27856750-27856772 TTCCCTTTGGGGGCTGTGTCAGG - Intronic
1148791606 17:50176319-50176341 GTCCCTCTGTCTGTTGTGTTTGG + Intergenic
1152427607 17:80226751-80226773 TTCCCGCTGGATGGTCTGGCAGG - Intronic
1152677504 17:81649025-81649047 CTTCCCCTGGATGTGGTGTCAGG + Intergenic
1152713929 17:81889172-81889194 GTCCCTCTGGATGGTGAGTCTGG - Exonic
1152947162 17:83204113-83204135 TTCCCCCAGGAGGGTGTGTCCGG + Intergenic
1153554666 18:6298842-6298864 TTCCCTCTTGTTGCTGAGTCTGG - Intronic
1155359594 18:24986719-24986741 TTCCATCTGAATGCTGTGTAAGG + Intergenic
1155667581 18:28329799-28329821 TTCACTCTTGGTGTTGTGTATGG + Intergenic
1155667610 18:28330249-28330271 TTCACTCTTGGTGTTGTGTATGG + Intergenic
1157519263 18:48334206-48334228 TTCCCTCAGCCTGTTGTGTGTGG - Intronic
1160583451 18:79900370-79900392 TTCCCTAGGGAGGTGGTGTCAGG - Intergenic
1162851027 19:13431173-13431195 TGCCCTCTGGCTGCTGTGTGGGG + Intronic
1163649327 19:18508046-18508068 TTCCCACTGGAGGCTATGTCAGG + Intronic
1164681130 19:30134535-30134557 ATCCCTCTGGCTGCTGTGTGCGG + Intergenic
1166364406 19:42271205-42271227 TGCCCTCTGGATCATGTGACAGG + Intronic
1166678920 19:44755948-44755970 GTCCCTCTGGCTGTTGTGTGGGG + Intronic
1168581470 19:57559167-57559189 GTCGCTCAGGATGTTGTTTCCGG - Intronic
925361168 2:3281238-3281260 TGCCCTCTGGTTGTGGTGGCTGG + Intronic
928023451 2:27721510-27721532 TTCCCGCGGGGTGTTGTGGCAGG - Intergenic
928442479 2:31303743-31303765 TTCCCTCTGGAAGGTGTCCCGGG + Intergenic
931016488 2:57987092-57987114 TTTCCTATGGATGTTTTCTCTGG - Intronic
932513934 2:72325639-72325661 TTCCCTCGAGAGTTTGTGTCTGG - Intronic
933085749 2:78052709-78052731 TTTCCCCTGGATGCTCTGTCTGG + Intergenic
934749220 2:96781580-96781602 TGCCCTCTGCCTGTGGTGTCAGG + Intronic
938574643 2:132592611-132592633 ATCACTCTGGATGCTGTGTTGGG + Intronic
942528448 2:176881716-176881738 ATCCCTCTGGCTGTTATGACTGG + Intergenic
943006024 2:182388276-182388298 TTCCTTCTTGATTTTCTGTCTGG - Intronic
943700856 2:190986818-190986840 TTTCCTCTCTATGTTGTCTCTGG - Intronic
943975106 2:194465969-194465991 TTCCCTCTGGATGGGGTTTTTGG - Intergenic
944908022 2:204282244-204282266 TTCCCGCTGGGTGTTGGGTTGGG - Intergenic
945514983 2:210752473-210752495 TTCCCTTTGGAAGATGTGACAGG + Intergenic
946577716 2:221094415-221094437 TTCACCCTGGAGGTTGTATCAGG - Intergenic
946603835 2:221380108-221380130 TTAGATCTGGATGTTGTATCTGG - Intergenic
946890664 2:224272688-224272710 TTTCCCCTGGAAATTGTGTCTGG + Intergenic
947334127 2:229063671-229063693 TTCCCTGTTGATTTTCTGTCTGG + Intronic
948496271 2:238351789-238351811 TTCCCTCTGGACCTTGTGCATGG + Intronic
949006953 2:241655145-241655167 TTCCGTCTGGAGGCTGGGTCGGG + Intronic
1169397920 20:5251459-5251481 TTCCCTATTGATTTTCTGTCTGG + Intergenic
1173897226 20:46560234-46560256 TTCCATCTGTATGGTGGGTCAGG - Intronic
1176248479 20:64108954-64108976 TGCCATGTGGATGTTGAGTCCGG + Intergenic
1176532090 21:7977438-7977460 TTCCATCTGGATTTTATGTGAGG + Intergenic
1177212776 21:18091126-18091148 TTCCCTCTGTATGTGGGGACTGG - Intronic
1177736227 21:25093129-25093151 TTCCCTCTGTTTGTAGTTTCTGG - Intergenic
949709335 3:6856280-6856302 TGCCCTTTGGATGCAGTGTCTGG - Intronic
949936457 3:9119776-9119798 CTCCCTCTCCATGTAGTGTCAGG - Intronic
954634342 3:52063453-52063475 ATCCCTCTGGCTGCTGTGTGGGG - Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
955727379 3:61947805-61947827 TTCCCTCTAGATGCGGTGACTGG - Intronic
956999803 3:74872943-74872965 TTCCCTCTCGCTGTGCTGTCAGG + Intergenic
958031566 3:88117083-88117105 TTACCTCTGTATGTTCTTTCGGG - Intronic
967957693 3:194890317-194890339 ATTCCTCTGGGTGTTGTTTCTGG - Intergenic
968018374 3:195360467-195360489 TTCCTTGTGGATTTTCTGTCTGG - Intronic
972118307 4:35666900-35666922 TTCCCTCTGGCTGCGGTGTGTGG - Intergenic
972480660 4:39492957-39492979 CTCCTTCTGGATGTTGTGGCTGG - Intergenic
973626560 4:52778539-52778561 TTAGCTCGGGATGTTGTGGCAGG - Intergenic
977213091 4:94243888-94243910 TTCCCTCTGCATGTACTGTGTGG - Intronic
979832501 4:125318305-125318327 TTCCGTCTGGATCCTGTGTCTGG + Exonic
980802388 4:137769156-137769178 ATCACTCTGGCTGTTGTGTTGGG + Intergenic
983863031 4:172732085-172732107 TTCCTTGTTGATTTTGTGTCTGG + Intronic
986270216 5:6223689-6223711 TTCCCTTTGCCTGCTGTGTCTGG - Intergenic
987429223 5:17811517-17811539 TTCCCTCTGGAGGTTTGGTCTGG - Intergenic
989111421 5:37909984-37910006 TTTCCTCTGGACGGTGTGGCTGG - Intergenic
989113254 5:37927586-37927608 TTTCCTCTGGACGGTGTGGCTGG - Intergenic
989375757 5:40758156-40758178 TTCCCTCTGCATGTCTTGTTAGG - Intergenic
990670817 5:58128100-58128122 TTCCCTCTGGATGTCACGGCAGG + Intergenic
992525421 5:77605420-77605442 TTCCCTCTGGGAGTGGTGTGTGG + Intronic
994152112 5:96459447-96459469 TTTCCTCTTGATGTTATTTCTGG - Intergenic
994509628 5:100687827-100687849 TTCCTGCTTGATATTGTGTCCGG + Intergenic
997226602 5:132213924-132213946 TCCCCTCTGGAAATTGTGCCTGG + Exonic
998785777 5:145707291-145707313 CTCCCTCTTGATTTTGTGTCAGG + Intronic
999857180 5:155607452-155607474 TTCCCCTTGGAGGTTGTGTCTGG - Intergenic
1002906861 6:1456236-1456258 TTCCCACTTGGGGTTGTGTCCGG + Intergenic
1003965632 6:11249862-11249884 TTCCTTCTGGCTCCTGTGTCTGG + Intronic
1004145978 6:13066758-13066780 TTCCCTGTTTATGTTGTCTCAGG + Intronic
1004202636 6:13563795-13563817 TTCCCTCTGGGTGTACTGTAAGG + Intergenic
1005142342 6:22647163-22647185 TTCCCTGTGGATGTTTAGGCAGG - Intergenic
1005808590 6:29498867-29498889 TTCCTTTTTGATTTTGTGTCTGG + Intergenic
1006445953 6:34079904-34079926 ATCCCTCTGGCTGTTGTGCAGGG - Intronic
1007246896 6:40469598-40469620 TTCCCTCTGGCTCTTGGGTTTGG + Intronic
1007821286 6:44562171-44562193 ATCCCTCTGGTTCTTGAGTCAGG + Intergenic
1008393514 6:50980456-50980478 TTCCCACTGGCTGTTGCCTCTGG + Intergenic
1009325737 6:62345928-62345950 TTCCCTCTGGGAGCTCTGTCTGG - Intergenic
1009437812 6:63636936-63636958 TTCCCTCAGGATGTGTTGCCGGG + Intronic
1012232458 6:96776385-96776407 TTGCCACAGGATGTTCTGTCTGG + Intergenic
1012288153 6:97418883-97418905 TTCCTTGTGGATTTTCTGTCTGG + Intergenic
1012602409 6:101114488-101114510 TGCCCTCTGGATCTCCTGTCTGG - Intergenic
1013289153 6:108705936-108705958 TTCCCTGAGGAAGTTGTATCTGG - Intergenic
1015210595 6:130693598-130693620 TTCTCTCTGGATGGCATGTCTGG + Intergenic
1015851117 6:137573827-137573849 GTCCCTCTGGATGTAGTTCCAGG - Intergenic
1021591029 7:22262274-22262296 TGCCATCTGGATGTTGTTTTTGG - Intronic
1022348512 7:29542320-29542342 TTCCCTGTTGATATTCTGTCTGG - Intergenic
1023380645 7:39604185-39604207 CTTCCTCTGGATGTTCTGTGTGG - Intronic
1024450503 7:49536080-49536102 TTCCCTATTGATTTTATGTCTGG - Intergenic
1025526682 7:61822049-61822071 TTCCTTCTAGTTTTTGTGTCTGG - Intergenic
1025550048 7:62234605-62234627 TTCCTTCTAGTTTTTGTGTCTGG - Intergenic
1026599217 7:71761568-71761590 TCCCCTCTAGATTTTGTGTTTGG + Intergenic
1028107826 7:86901615-86901637 ATCCCTCTGGATTTTGTCTGAGG + Intronic
1028983000 7:96988021-96988043 GTCCCTGTGGAGGTTGTGTTTGG + Intergenic
1030829384 7:114202071-114202093 TTCCCTCTGGATGGTTTCTGAGG - Intronic
1031401248 7:121328635-121328657 TACCCTCTGGGTGTAGTGGCTGG - Intronic
1031936717 7:127742724-127742746 TTTCCTCTGAGTGTTGTGTTAGG + Intronic
1033111928 7:138587635-138587657 TTCCCTCTGGATTTGGGATCAGG + Exonic
1033755660 7:144396985-144397007 TTACTTCTGAATGTTGTATCAGG - Intergenic
1034450871 7:151136692-151136714 CTCCCTCAGGATTTTGGGTCGGG + Intronic
1038137892 8:24809472-24809494 TTCCTCATGGATGTTGTATCTGG - Intergenic
1038245976 8:25856704-25856726 TTCCTCCTGGAGGTGGTGTCTGG - Intronic
1043328857 8:79088073-79088095 TTCATTCTTGATGTTGAGTCTGG + Intergenic
1043751712 8:83944133-83944155 TTCCCTATTGATTTTCTGTCTGG + Intergenic
1046250691 8:111626552-111626574 TTCCTTGTTGATGTTCTGTCTGG + Intergenic
1047214238 8:122863800-122863822 TGCCCTCTGGATGGTGAGTCTGG - Intronic
1050400791 9:5251617-5251639 TTCCTTATGGATTTTGTGTCTGG - Intergenic
1050564603 9:6869226-6869248 TTTCATCTGAATGTTATGTCAGG + Intronic
1050999526 9:12264037-12264059 TTTCTTCTGGATGTCGTCTCTGG - Intergenic
1056823048 9:89857049-89857071 TTTCCTCTTGATTTTCTGTCTGG - Intergenic
1058792221 9:108460030-108460052 TTCCTTATGGATTTTTTGTCTGG - Intergenic
1059073710 9:111166741-111166763 TTCCCTCTTGATGCTGGGTCTGG - Intergenic
1059890143 9:118792836-118792858 TTGCCTCTGGATCTTTAGTCTGG + Intergenic
1061039916 9:128135229-128135251 TTTCCTCTTGATTTTCTGTCTGG + Intergenic
1187033935 X:15517786-15517808 ATCACTCCAGATGTTGTGTCTGG + Intronic
1188441187 X:30216339-30216361 TTTCCTCTGGAGGTGGTCTCAGG + Intronic
1189555649 X:42142543-42142565 TTCCATTTGGGTGTTGTGTATGG - Intergenic
1190927070 X:54919887-54919909 TTCCCTATCGATTTTCTGTCTGG + Intergenic
1192789291 X:74365468-74365490 TACCCTCTGGATGTTGTCATTGG - Intergenic
1195429638 X:104774131-104774153 TCACCTCTGAATGTCGTGTCTGG - Intronic
1196984227 X:121250632-121250654 TTCCTTGTTGATTTTGTGTCTGG + Intergenic
1197110602 X:122769763-122769785 TTCCCTTTGCATGTTTTGTAGGG + Intergenic
1197370329 X:125618753-125618775 TTTCCTCTAGATGTTATGTTAGG + Intergenic
1197437096 X:126444191-126444213 TTCCTTCTTGATTTTCTGTCTGG + Intergenic
1197596704 X:128472414-128472436 TTTCCTTTGTATGTAGTGTCTGG + Intergenic
1198629647 X:138621076-138621098 TTCCCTATTGATTTTCTGTCTGG - Intergenic
1199835303 X:151584202-151584224 TTTCTTCTGGATGTATTGTCTGG - Intronic
1200210187 X:154343678-154343700 CTCCCTCTGGAGGCTGTGGCAGG + Intergenic
1200220665 X:154388414-154388436 CTCCCTCTGGAGGCTGTGGCAGG - Intergenic
1201228676 Y:11842801-11842823 ATCACTCTGGCTGTTGTGTAAGG - Intergenic
1202195770 Y:22297369-22297391 TTCCCTCCGGATGTCATTTCAGG - Intergenic