ID: 1122740930 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:103871343-103871365 |
| Sequence | CTGGGGAGGCTGAGGTAGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1122740923_1122740930 | -7 | Left | 1122740923 | 14:103871327-103871349 | CCTGTAGTCCCAGATACTGGGGA | 0: 41 1: 5266 2: 114605 3: 242556 4: 248019 |
||
| Right | 1122740930 | 14:103871343-103871365 | CTGGGGAGGCTGAGGTAGGAGGG | No data | ||||
| 1122740919_1122740930 | 12 | Left | 1122740919 | 14:103871308-103871330 | CCAGGCATGGTGGCTTGCGCCTG | 0: 70 1: 2088 2: 27356 3: 108142 4: 216161 |
||
| Right | 1122740930 | 14:103871343-103871365 | CTGGGGAGGCTGAGGTAGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1122740930 | Original CRISPR | CTGGGGAGGCTGAGGTAGGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||