ID: 1122740930

View in Genome Browser
Species Human (GRCh38)
Location 14:103871343-103871365
Sequence CTGGGGAGGCTGAGGTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122740923_1122740930 -7 Left 1122740923 14:103871327-103871349 CCTGTAGTCCCAGATACTGGGGA 0: 41
1: 5266
2: 114605
3: 242556
4: 248019
Right 1122740930 14:103871343-103871365 CTGGGGAGGCTGAGGTAGGAGGG No data
1122740919_1122740930 12 Left 1122740919 14:103871308-103871330 CCAGGCATGGTGGCTTGCGCCTG 0: 70
1: 2088
2: 27356
3: 108142
4: 216161
Right 1122740930 14:103871343-103871365 CTGGGGAGGCTGAGGTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122740930 Original CRISPR CTGGGGAGGCTGAGGTAGGA GGG Intergenic
No off target data available for this crispr