ID: 1122743600

View in Genome Browser
Species Human (GRCh38)
Location 14:103885595-103885617
Sequence GGTGGTGCTGACCTCGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122743598_1122743600 -9 Left 1122743598 14:103885581-103885603 CCGAGGTCAGGGCCGGTGGTGCT No data
Right 1122743600 14:103885595-103885617 GGTGGTGCTGACCTCGAAAGTGG No data
1122743594_1122743600 -2 Left 1122743594 14:103885574-103885596 CCCACAGCCGAGGTCAGGGCCGG No data
Right 1122743600 14:103885595-103885617 GGTGGTGCTGACCTCGAAAGTGG No data
1122743588_1122743600 26 Left 1122743588 14:103885546-103885568 CCTGCATGCTCAGGAGCGTCCTT No data
Right 1122743600 14:103885595-103885617 GGTGGTGCTGACCTCGAAAGTGG No data
1122743593_1122743600 1 Left 1122743593 14:103885571-103885593 CCTCCCACAGCCGAGGTCAGGGC No data
Right 1122743600 14:103885595-103885617 GGTGGTGCTGACCTCGAAAGTGG No data
1122743596_1122743600 -3 Left 1122743596 14:103885575-103885597 CCACAGCCGAGGTCAGGGCCGGT No data
Right 1122743600 14:103885595-103885617 GGTGGTGCTGACCTCGAAAGTGG No data
1122743590_1122743600 7 Left 1122743590 14:103885565-103885587 CCTTGTCCTCCCACAGCCGAGGT No data
Right 1122743600 14:103885595-103885617 GGTGGTGCTGACCTCGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122743600 Original CRISPR GGTGGTGCTGACCTCGAAAG TGG Intergenic