ID: 1122743693

View in Genome Browser
Species Human (GRCh38)
Location 14:103885954-103885976
Sequence CTGGCCCATCAGGCTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122743693_1122743710 15 Left 1122743693 14:103885954-103885976 CCTCCTGAAGCCTGATGGGCCAG No data
Right 1122743710 14:103885992-103886014 TTGTGGGGTAGGTATGAGGAAGG No data
1122743693_1122743709 11 Left 1122743693 14:103885954-103885976 CCTCCTGAAGCCTGATGGGCCAG No data
Right 1122743709 14:103885988-103886010 CGGTTTGTGGGGTAGGTATGAGG No data
1122743693_1122743703 0 Left 1122743693 14:103885954-103885976 CCTCCTGAAGCCTGATGGGCCAG No data
Right 1122743703 14:103885977-103885999 GGAGGAGCCCCCGGTTTGTGGGG No data
1122743693_1122743701 -2 Left 1122743693 14:103885954-103885976 CCTCCTGAAGCCTGATGGGCCAG No data
Right 1122743701 14:103885975-103885997 AGGGAGGAGCCCCCGGTTTGTGG No data
1122743693_1122743699 -9 Left 1122743693 14:103885954-103885976 CCTCCTGAAGCCTGATGGGCCAG No data
Right 1122743699 14:103885968-103885990 ATGGGCCAGGGAGGAGCCCCCGG No data
1122743693_1122743711 16 Left 1122743693 14:103885954-103885976 CCTCCTGAAGCCTGATGGGCCAG No data
Right 1122743711 14:103885993-103886015 TGTGGGGTAGGTATGAGGAAGGG No data
1122743693_1122743704 4 Left 1122743693 14:103885954-103885976 CCTCCTGAAGCCTGATGGGCCAG No data
Right 1122743704 14:103885981-103886003 GAGCCCCCGGTTTGTGGGGTAGG No data
1122743693_1122743702 -1 Left 1122743693 14:103885954-103885976 CCTCCTGAAGCCTGATGGGCCAG No data
Right 1122743702 14:103885976-103885998 GGGAGGAGCCCCCGGTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122743693 Original CRISPR CTGGCCCATCAGGCTTCAGG AGG (reversed) Intergenic
No off target data available for this crispr