ID: 1122748086

View in Genome Browser
Species Human (GRCh38)
Location 14:103911647-103911669
Sequence GGGCTGTGTGAGAAGTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122748086_1122748095 19 Left 1122748086 14:103911647-103911669 CCTGCAAACTTCTCACACAGCCC No data
Right 1122748095 14:103911689-103911711 GAGGAAGCCATGACAGGTTTTGG No data
1122748086_1122748091 0 Left 1122748086 14:103911647-103911669 CCTGCAAACTTCTCACACAGCCC No data
Right 1122748091 14:103911670-103911692 AACAACCCTGAGGCTGTTGGAGG No data
1122748086_1122748089 -3 Left 1122748086 14:103911647-103911669 CCTGCAAACTTCTCACACAGCCC No data
Right 1122748089 14:103911667-103911689 CCCAACAACCCTGAGGCTGTTGG No data
1122748086_1122748087 -10 Left 1122748086 14:103911647-103911669 CCTGCAAACTTCTCACACAGCCC No data
Right 1122748087 14:103911660-103911682 CACACAGCCCAACAACCCTGAGG No data
1122748086_1122748094 13 Left 1122748086 14:103911647-103911669 CCTGCAAACTTCTCACACAGCCC No data
Right 1122748094 14:103911683-103911705 CTGTTGGAGGAAGCCATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122748086 Original CRISPR GGGCTGTGTGAGAAGTTTGC AGG (reversed) Intergenic
No off target data available for this crispr