ID: 1122748088

View in Genome Browser
Species Human (GRCh38)
Location 14:103911667-103911689
Sequence CCAACAGCCTCAGGGTTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122748088_1122748094 -7 Left 1122748088 14:103911667-103911689 CCCAACAACCCTGAGGCTGTTGG No data
Right 1122748094 14:103911683-103911705 CTGTTGGAGGAAGCCATGACAGG No data
1122748088_1122748097 22 Left 1122748088 14:103911667-103911689 CCCAACAACCCTGAGGCTGTTGG No data
Right 1122748097 14:103911712-103911734 TTGTCTTACAAAAGAAACTGAGG No data
1122748088_1122748095 -1 Left 1122748088 14:103911667-103911689 CCCAACAACCCTGAGGCTGTTGG No data
Right 1122748095 14:103911689-103911711 GAGGAAGCCATGACAGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122748088 Original CRISPR CCAACAGCCTCAGGGTTGTT GGG (reversed) Intergenic
No off target data available for this crispr