ID: 1122748094

View in Genome Browser
Species Human (GRCh38)
Location 14:103911683-103911705
Sequence CTGTTGGAGGAAGCCATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122748086_1122748094 13 Left 1122748086 14:103911647-103911669 CCTGCAAACTTCTCACACAGCCC No data
Right 1122748094 14:103911683-103911705 CTGTTGGAGGAAGCCATGACAGG No data
1122748088_1122748094 -7 Left 1122748088 14:103911667-103911689 CCCAACAACCCTGAGGCTGTTGG No data
Right 1122748094 14:103911683-103911705 CTGTTGGAGGAAGCCATGACAGG No data
1122748090_1122748094 -8 Left 1122748090 14:103911668-103911690 CCAACAACCCTGAGGCTGTTGGA No data
Right 1122748094 14:103911683-103911705 CTGTTGGAGGAAGCCATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122748094 Original CRISPR CTGTTGGAGGAAGCCATGAC AGG Intergenic
No off target data available for this crispr