ID: 1122748095

View in Genome Browser
Species Human (GRCh38)
Location 14:103911689-103911711
Sequence GAGGAAGCCATGACAGGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122748093_1122748095 -10 Left 1122748093 14:103911676-103911698 CCTGAGGCTGTTGGAGGAAGCCA No data
Right 1122748095 14:103911689-103911711 GAGGAAGCCATGACAGGTTTTGG No data
1122748088_1122748095 -1 Left 1122748088 14:103911667-103911689 CCCAACAACCCTGAGGCTGTTGG No data
Right 1122748095 14:103911689-103911711 GAGGAAGCCATGACAGGTTTTGG No data
1122748086_1122748095 19 Left 1122748086 14:103911647-103911669 CCTGCAAACTTCTCACACAGCCC No data
Right 1122748095 14:103911689-103911711 GAGGAAGCCATGACAGGTTTTGG No data
1122748092_1122748095 -9 Left 1122748092 14:103911675-103911697 CCCTGAGGCTGTTGGAGGAAGCC No data
Right 1122748095 14:103911689-103911711 GAGGAAGCCATGACAGGTTTTGG No data
1122748090_1122748095 -2 Left 1122748090 14:103911668-103911690 CCAACAACCCTGAGGCTGTTGGA No data
Right 1122748095 14:103911689-103911711 GAGGAAGCCATGACAGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122748095 Original CRISPR GAGGAAGCCATGACAGGTTT TGG Intergenic