ID: 1122748097

View in Genome Browser
Species Human (GRCh38)
Location 14:103911712-103911734
Sequence TTGTCTTACAAAAGAAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122748090_1122748097 21 Left 1122748090 14:103911668-103911690 CCAACAACCCTGAGGCTGTTGGA No data
Right 1122748097 14:103911712-103911734 TTGTCTTACAAAAGAAACTGAGG No data
1122748093_1122748097 13 Left 1122748093 14:103911676-103911698 CCTGAGGCTGTTGGAGGAAGCCA No data
Right 1122748097 14:103911712-103911734 TTGTCTTACAAAAGAAACTGAGG No data
1122748096_1122748097 -7 Left 1122748096 14:103911696-103911718 CCATGACAGGTTTTGGTTGTCTT No data
Right 1122748097 14:103911712-103911734 TTGTCTTACAAAAGAAACTGAGG No data
1122748092_1122748097 14 Left 1122748092 14:103911675-103911697 CCCTGAGGCTGTTGGAGGAAGCC No data
Right 1122748097 14:103911712-103911734 TTGTCTTACAAAAGAAACTGAGG No data
1122748088_1122748097 22 Left 1122748088 14:103911667-103911689 CCCAACAACCCTGAGGCTGTTGG No data
Right 1122748097 14:103911712-103911734 TTGTCTTACAAAAGAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122748097 Original CRISPR TTGTCTTACAAAAGAAACTG AGG Intergenic