ID: 1122758664

View in Genome Browser
Species Human (GRCh38)
Location 14:104003473-104003495
Sequence ATATCTATCTAGAAGGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 163}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122758664_1122758675 26 Left 1122758664 14:104003473-104003495 CCTTCACCCTTCTAGATAGATAT 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1122758675 14:104003522-104003544 GGTGGGGAAAGAATGCTTTTTGG 0: 1
1: 0
2: 0
3: 26
4: 268
1122758664_1122758668 5 Left 1122758664 14:104003473-104003495 CCTTCACCCTTCTAGATAGATAT 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1122758668 14:104003501-104003523 GTTAGGATCTAGATCCCCATAGG 0: 1
1: 0
2: 1
3: 0
4: 52
1122758664_1122758669 8 Left 1122758664 14:104003473-104003495 CCTTCACCCTTCTAGATAGATAT 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1122758669 14:104003504-104003526 AGGATCTAGATCCCCATAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 58
1122758664_1122758676 27 Left 1122758664 14:104003473-104003495 CCTTCACCCTTCTAGATAGATAT 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1122758676 14:104003523-104003545 GTGGGGAAAGAATGCTTTTTGGG 0: 1
1: 1
2: 1
3: 22
4: 302
1122758664_1122758670 9 Left 1122758664 14:104003473-104003495 CCTTCACCCTTCTAGATAGATAT 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1122758670 14:104003505-104003527 GGATCTAGATCCCCATAGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1122758664_1122758671 10 Left 1122758664 14:104003473-104003495 CCTTCACCCTTCTAGATAGATAT 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1122758671 14:104003506-104003528 GATCTAGATCCCCATAGGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122758664 Original CRISPR ATATCTATCTAGAAGGGTGA AGG (reversed) Intronic
904861451 1:33541040-33541062 GCATCTCTCTAGAAGGGAGAGGG - Intronic
906724675 1:48035605-48035627 ACATCTGGCTAGAAGGGGGAGGG + Intergenic
908488106 1:64615205-64615227 ATTCTTATCTAGAAGGGTGAGGG - Intronic
909307729 1:74102605-74102627 ATAAATATCTAGAAGTGGGATGG - Intronic
909735777 1:78959848-78959870 ATATCTATCAAGAAGGTTCATGG - Intronic
910801909 1:91155375-91155397 ATAGCTAACTGGAAGCGTGAGGG + Intergenic
912678936 1:111715864-111715886 ATGTGTATCTACAAGGGTAATGG - Exonic
915455038 1:156034814-156034836 ATATATATATAGAAGGTTAAGGG - Intergenic
916231668 1:162546593-162546615 ATATTTATCTAAATGGGTGCTGG + Intergenic
916255858 1:162787655-162787677 ATTTCTATAAAGAAGGGAGAGGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919294729 1:195681840-195681862 ATACATACCTAGAAGAGTGAAGG + Intergenic
920817521 1:209348818-209348840 ATTTCTATCTAGTTGTGTGATGG - Intergenic
924294018 1:242567264-242567286 ATATCTATAATGAAGGGTGAGGG + Intergenic
924495593 1:244585598-244585620 ATATTTATCTGGGAGGCTGATGG - Intronic
1064805854 10:19131295-19131317 ATATCTAGCAAGAATGCTGAAGG + Intronic
1064942270 10:20748202-20748224 ATATCTTTTTTGAAAGGTGAAGG - Intergenic
1065635047 10:27723366-27723388 AAATCTATCCAGATGGGTCAAGG - Intronic
1065676369 10:28178681-28178703 ATATCTATCTAAAGGGTTGCTGG + Intronic
1066722323 10:38353324-38353346 ATTTCTATAAAGAAGGGAGAGGG - Intergenic
1066976426 10:42372236-42372258 ATACCCATCCAGAAGAGTGAAGG + Intergenic
1068725356 10:60294883-60294905 AAATCTTTCTAGAAGTGCGAAGG + Intronic
1069086204 10:64142472-64142494 ATAGCAATTTAGCAGGGTGATGG - Intergenic
1073018243 10:100419322-100419344 AAATCTATTGAGAAGGCTGAAGG + Intergenic
1075618160 10:123906280-123906302 ATGTCTACCTAGAAGAGAGATGG + Intronic
1075981087 10:126740161-126740183 CTTTCTTTCTAGAAAGGTGATGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1081066134 11:38542288-38542310 ACATCTATCTAGCAGGTTAAAGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1085846596 11:80073067-80073089 CTATCTATCTTGAAGGGAGAAGG + Intergenic
1086725749 11:90181535-90181557 ATATCAATCTGGAATGGGGAGGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087318221 11:96629690-96629712 ATATCTTTCTAGAGGTTTGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092723051 12:11460738-11460760 CTATCTATAGAGTAGGGTGAAGG + Intronic
1092873281 12:12826218-12826240 ATACCTATCTAGCAGGGTTTTGG + Intronic
1095839346 12:46675402-46675424 ATATCTCTCTAGGGTGGTGAGGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097676817 12:62611809-62611831 ATATATATATATAAGGTTGAAGG + Intergenic
1098941904 12:76547658-76547680 AAGTGTATCTAGATGGGTGAGGG - Intronic
1100645313 12:96523087-96523109 ATATCCATCTAGAACAGTCAGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101473696 12:105023488-105023510 ATATCTTTTAAGAATGGTGACGG + Exonic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1107954059 13:45493561-45493583 TTATCTATTTAGTGGGGTGAGGG - Intronic
1108977147 13:56460904-56460926 CTATCTATCTAGGAGAGAGAGGG + Intergenic
1109235580 13:59813963-59813985 GTATGTATCTATAAGGGAGATGG + Intronic
1111243048 13:85501064-85501086 ATATCTATCTCCAAGGAAGAAGG - Intergenic
1112422241 13:99262859-99262881 ACATGTATCTATAAGGTTGAGGG + Intronic
1112486629 13:99826006-99826028 GGATCTTTCTAGAAGGGAGAAGG + Intronic
1114412153 14:22511233-22511255 ATATCTCTCTAGAAGAAAGAGGG - Intergenic
1114536030 14:23423364-23423386 ATATCTTTCTAGAAAGGAGCTGG - Intronic
1115525612 14:34277504-34277526 ATATTTCTCTAGAAGGGTTAGGG - Intronic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1119179343 14:72594444-72594466 AGATCTTTCTAGAAGGCTGGGGG - Intergenic
1120649792 14:87118438-87118460 ATACCACTCTAGAAGAGTGAAGG - Intergenic
1121159668 14:91726059-91726081 ATGGCTACCTAGAAGGGGGATGG - Intronic
1122169094 14:99856665-99856687 ATATCTATCTAAACTGGAGAGGG - Intronic
1122758664 14:104003473-104003495 ATATCTATCTAGAAGGGTGAAGG - Intronic
1123578764 15:21697506-21697528 ATAAGTATCTCAAAGGGTGATGG + Intergenic
1123615391 15:22139988-22140010 ATAAGTATCTCAAAGGGTGATGG + Intergenic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1130423842 15:83775525-83775547 ATATATCTCCAGAAGGCTGAAGG + Intronic
1131484892 15:92812009-92812031 ATATCAATTTAGAAGAGTGAGGG - Intergenic
1202987634 15_KI270727v1_random:431751-431773 ATAAGTATCTCAAAGGGTGATGG + Intergenic
1135555626 16:23433944-23433966 ACATCTATTCAGAAGAGTGATGG - Intronic
1140592452 16:76369930-76369952 ATATCTGCCTACAATGGTGAGGG + Intronic
1140636733 16:76923751-76923773 ACAGCTAACCAGAAGGGTGAAGG - Intergenic
1141143852 16:81515343-81515365 TTTTCCATCTAGAAGCGTGAGGG - Intronic
1141453034 16:84118273-84118295 ATATCTACCTTAAAGGATGAGGG + Intergenic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1148570336 17:48663167-48663189 ATAGTTATCTGGTAGGGTGATGG + Intergenic
1148584155 17:48765463-48765485 ATATTTATCTAGAAGAGTGCTGG + Intronic
1149825812 17:59827073-59827095 AACTCTATCTAGAAGGATGCTGG - Intronic
1150648437 17:66994428-66994450 AGATCTATCTCCCAGGGTGAGGG - Intronic
1153965039 18:10172148-10172170 ATGTCTATCTAGAAAGGTGAAGG + Intergenic
1155438928 18:25841563-25841585 ACATTTATCTTGAATGGTGATGG - Intergenic
1158383190 18:56958697-56958719 ATACATTTCTAGAAGGGTCATGG + Intronic
1158890978 18:61871426-61871448 ATATCTATCTCGAGAGGTCATGG - Intronic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1167130605 19:47582828-47582850 AAAACTATCTAGTGGGGTGAGGG + Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
929023571 2:37577575-37577597 CTATCTCTCTAGAAGGAGGAAGG + Intergenic
930710557 2:54547466-54547488 ATATATATCCAGAAGGGGAATGG + Intronic
931782804 2:65593603-65593625 ATAACTATATAGATGGGTTAAGG - Intergenic
942021486 2:171870725-171870747 ATATCAATATAGAAATGTGAAGG + Intronic
943833930 2:192495106-192495128 ATTTCCATCTAGAAGGGGAAAGG - Intergenic
944286404 2:197955128-197955150 ACAACTATCTAGAAGAGTGGTGG - Intronic
1169381825 20:5113740-5113762 ATTTCCATCTAGATTGGTGATGG - Intergenic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1177441861 21:21136278-21136300 ATAACTAACTTTAAGGGTGAAGG + Intronic
1179576154 21:42309783-42309805 ATTTGTATCTAGAAGGGGCAGGG + Intergenic
1181824920 22:25507327-25507349 ATATGTATATGGATGGGTGAAGG - Intergenic
1182959936 22:34462724-34462746 ATGTCCAACTAGCAGGGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951275827 3:20684832-20684854 ATATCTATATAGAATGGTGCTGG + Intergenic
951688860 3:25374459-25374481 ATGCCTAGCTTGAAGGGTGAAGG + Intronic
956246690 3:67191437-67191459 ATTTCTTTCTAGTATGGTGATGG + Intergenic
959103386 3:102039401-102039423 CTTTCTATCTGGAAGAGTGAAGG + Intergenic
959963270 3:112325032-112325054 ATATCTAGCTAGTAGATTGATGG - Intergenic
961150009 3:124629606-124629628 GTATCTGAATAGAAGGGTGAAGG - Intronic
961848186 3:129786597-129786619 ATATATATTTAGAAGAGGGAAGG - Intronic
962055332 3:131865550-131865572 ATAATTATCTTGTAGGGTGATGG - Intronic
962653479 3:137518893-137518915 ATATCTATTTTGAATGGTGGAGG + Intergenic
963559570 3:146846382-146846404 ATATCTATCTATAAAGTTTATGG - Intergenic
965145457 3:164896044-164896066 ATATATATCTAGAAGTGGAAAGG - Intergenic
966422576 3:179747832-179747854 ATATCTATCTAGAATCCTGGAGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968182576 3:196607260-196607282 AAATCTATATAGAAGAGTAAAGG - Intergenic
971858784 4:32078377-32078399 ATATTTATCGAGGAAGGTGAAGG + Intergenic
975774192 4:77766090-77766112 ATATCTGTCTAGAACTGTAAAGG - Intronic
976751405 4:88454300-88454322 ATATATATCTAGCAAGGTTAGGG - Intergenic
977635370 4:99292301-99292323 ATATCTCTCTAGAATTGTAAAGG + Intergenic
982649283 4:158066341-158066363 ATATCTATGTAGAAAGGTTTAGG - Intergenic
982740199 4:159049950-159049972 ATATCTATCAAGAAGCTTTAAGG - Intergenic
983396582 4:167204938-167204960 ATAGCTACCTAGGAGGCTGAGGG - Intronic
983780016 4:171658391-171658413 ATATCTCACTAGGAGGTTGACGG + Intergenic
984768576 4:183418790-183418812 TTATTTATTTTGAAGGGTGAGGG - Intergenic
986023548 5:3827488-3827510 ATCTATATAAAGAAGGGTGATGG + Intergenic
986506123 5:8453826-8453848 ATATATATATAGAAGGGTTGTGG + Intergenic
988089706 5:26521222-26521244 ATTTCTATCAAGAATTGTGAAGG + Intergenic
988910485 5:35835930-35835952 ACATCTACCTAGAAAGTTGAGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990633165 5:57693106-57693128 ATGTCTGTCTAGAAGGATTAAGG - Intergenic
991244523 5:64496076-64496098 ACATCTTTCAAGAAAGGTGAAGG + Intergenic
992045288 5:72881827-72881849 ATATTTATCTGGTACGGTGAGGG - Intronic
994366092 5:98918789-98918811 ATATATATTCAGAAGGGTGTTGG - Intronic
995563263 5:113405991-113406013 ATAATTATTTAGAAGGGGGATGG - Intronic
997559464 5:134833435-134833457 AAATGTATGTAGAGGGGTGAGGG + Intronic
998164428 5:139834930-139834952 ATATATATATATATGGGTGATGG - Intronic
998192697 5:140041074-140041096 GTATCGATCTAGAAAGATGAAGG + Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007461394 6:42021750-42021772 AGATCTAGCTAGCAGGGAGAGGG + Intronic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1014045410 6:116878602-116878624 ATATCTATCTAAAAGAAAGACGG + Intronic
1014541719 6:122683850-122683872 ATAAATATCCAGAAGTGTGATGG - Intronic
1016727002 6:147383357-147383379 ATATCTATCTGGAAGACTCAAGG - Intronic
1018655438 6:166029730-166029752 CTTTCAATCAAGAAGGGTGAAGG - Intergenic
1019968486 7:4520950-4520972 ATATCTATCATGTAGGGTTAAGG - Intergenic
1020286267 7:6683520-6683542 CCAGCTATCTGGAAGGGTGAAGG + Intergenic
1020548095 7:9559564-9559586 ATATTTATCTGGTGGGGTGATGG - Intergenic
1023244442 7:38186075-38186097 ATTACTATCTAGACAGGTGAAGG - Intronic
1028081043 7:86576946-86576968 AAATATATCTGGAAGGTTGATGG - Intergenic
1028279327 7:88901582-88901604 ATAAATATCTAGATGAGTGATGG - Intronic
1028916442 7:96264315-96264337 ATAGTTATCTAGAAGTGGGAGGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030499120 7:110337066-110337088 ACATCTATGTGAAAGGGTGAGGG - Intergenic
1030629622 7:111881558-111881580 ATATATATCCAGTAGGGGGATGG - Intronic
1033440782 7:141376563-141376585 ATATCTATCTAAAATTTTGATGG - Intronic
1033471513 7:141653756-141653778 ATATCAACTTAGATGGGTGAGGG - Exonic
1035830337 8:2688521-2688543 ATATCCATCCGGAGGGGTGAGGG + Intergenic
1036652227 8:10652347-10652369 ATATCCATCCAGAAGGGTTGGGG + Intronic
1038377496 8:27057146-27057168 AGATCTAACTAGAACAGTGATGG + Intergenic
1038825281 8:30992315-30992337 ATCTCTATTAAGAAGGGTCATGG + Intergenic
1041190173 8:55345472-55345494 ATTTCTATCTAGGAAGGAGATGG + Intronic
1044817880 8:96131506-96131528 ATATCTAGAAAGAAGTGTGAAGG - Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1047677049 8:127213667-127213689 ATATCTATCTAGAGTGTTGAAGG + Intergenic
1048593537 8:135843656-135843678 CTACCTAGCTAGAAGGCTGATGG - Intergenic
1050079145 9:1897059-1897081 AAATCTATATAGAAAGGTAATGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052350762 9:27456137-27456159 ATCTGTATCTAGAAGGATGGGGG - Intronic
1053194477 9:36105767-36105789 ATATATAACTTTAAGGGTGAAGG + Intronic
1055880005 9:80989558-80989580 ATACCTAACAAGAAGGGAGAAGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056384533 9:86084719-86084741 ATATTTAACTAGAAGGTTCAAGG - Intronic
1057549619 9:96042633-96042655 ATATCTATCTAGAAGGCATGAGG - Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058628592 9:106961785-106961807 ATGTGTATCTAGAAGGGTCAAGG + Intronic
1058895368 9:109396285-109396307 ATGTCTTTCTGGAAGGGTCAGGG + Intronic
1059552994 9:115249154-115249176 ATATATACCTAGAAGTGAGAGGG + Intronic
1059631772 9:116132213-116132235 ATATATATCCAGAAGTGGGATGG - Intergenic
1059739320 9:117134394-117134416 TTATCTATCAAGAAGGATAAAGG + Intronic
1061297229 9:129683283-129683305 ATATCTGTCTATAAAGATGAGGG - Intronic
1187943672 X:24406151-24406173 AAATCTCCCTAGAAGGGTAAGGG - Intergenic
1189664623 X:43340546-43340568 ATGCCTATCCAGAAGGGTGAAGG - Intergenic
1191643885 X:63457795-63457817 ATGTCCATCTAGAATGATGAAGG + Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1198804708 X:140482162-140482184 AAATCTACCTAGAAAGGTGGAGG + Intergenic
1199441447 X:147872845-147872867 CTATCTATCTAGAAGAATGAAGG - Intergenic