ID: 1122762142

View in Genome Browser
Species Human (GRCh38)
Location 14:104037166-104037188
Sequence GGGGGTCTTCAGTACAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122762135_1122762142 18 Left 1122762135 14:104037125-104037147 CCTTTCACTTTAAATATGCAGTC 0: 1
1: 0
2: 1
3: 26
4: 229
Right 1122762142 14:104037166-104037188 GGGGGTCTTCAGTACAGAACTGG 0: 1
1: 0
2: 1
3: 5
4: 111
1122762134_1122762142 23 Left 1122762134 14:104037120-104037142 CCTTTCCTTTCACTTTAAATATG 0: 1
1: 0
2: 2
3: 53
4: 739
Right 1122762142 14:104037166-104037188 GGGGGTCTTCAGTACAGAACTGG 0: 1
1: 0
2: 1
3: 5
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122762142 Original CRISPR GGGGGTCTTCAGTACAGAAC TGG Intronic
900236472 1:1594046-1594068 GGGGGTCTTGACTACTGGACGGG - Intergenic
908931082 1:69316324-69316346 GGGGGTGTTCGGTCCAGAACAGG + Intergenic
911084676 1:93966473-93966495 GGGGGACTTCTGGAAAGAACTGG - Intergenic
913937105 1:125065307-125065329 GGGAGTCTTGAGAACACAACAGG - Intergenic
914295921 1:146324571-146324593 GGAGGTCTTACATACAGAACAGG + Intergenic
914556961 1:148775347-148775369 GGAGGTCTTACATACAGAACAGG + Intergenic
914615873 1:149354883-149354905 GGAGGTCTTACATACAGAACAGG - Intergenic
920087289 1:203426865-203426887 CGGGGTCTGCAGGACAGACCTGG - Intergenic
920281049 1:204843908-204843930 GGGGGTTTTTAGTACAGACGGGG + Intronic
920313593 1:205062423-205062445 TGGGCTCTTCTGCACAGAACCGG + Exonic
921860100 1:220033907-220033929 GGGGCACTTCAGGAAAGAACAGG + Intronic
1062800595 10:376511-376533 GGGGGTCTTCCCTTCTGAACTGG + Intronic
1069213029 10:65785331-65785353 GGTGGCATTCAGTTCAGAACAGG + Intergenic
1076772949 10:132676997-132677019 GTGGGTCTACAGTTCAGGACAGG - Intronic
1076772963 10:132677057-132677079 GTGGGTCTACAGTTCAGGACAGG - Intronic
1077353447 11:2103671-2103693 GGGGTGCTGCAGTACAGAGCAGG + Intergenic
1081683400 11:45024647-45024669 GGGAGTCTGCAGTACAGGAGAGG + Intergenic
1089993692 11:122884717-122884739 GGAGGTCTACATTACCGAACGGG - Intronic
1092340100 12:7668305-7668327 GGAGGTCTGAAGTACAAAACAGG - Intergenic
1097964188 12:65561712-65561734 GGCCATCTTCAGAACAGAACTGG - Intergenic
1102152305 12:110697221-110697243 GGGCGTCATCAGTGCACAACTGG + Intronic
1105831351 13:24165292-24165314 GTGGGTCTTCAGGGCAGACCTGG - Intronic
1107271937 13:38629835-38629857 GAGGTTCTTCAGTATAGAAATGG - Intergenic
1119592124 14:75899729-75899751 GAGGATCTTCAGTAAAGAACGGG + Intronic
1122762142 14:104037166-104037188 GGGGGTCTTCAGTACAGAACTGG + Intronic
1123896644 15:24836956-24836978 GAGGGTCTTCAGGAGAGAAGAGG + Intronic
1126492067 15:49247965-49247987 AGAGGTCTCCAGTACAGAACAGG - Intronic
1127763398 15:62163692-62163714 GGGGGTCCTGTGAACAGAACAGG + Exonic
1130207537 15:81891275-81891297 TGGGGTCTTCAGTACTCAGCAGG + Intergenic
1130774072 15:86959339-86959361 TGGGTTCTTAGGTACAGAACTGG - Intronic
1133396114 16:5448930-5448952 GGGGGTCTGCAGTAGAGAGTGGG - Intergenic
1134694610 16:16214332-16214354 GGGGGTCTTCAGGGAAGAAGGGG + Exonic
1134977226 16:18580305-18580327 GGGGGTCTTCAGGGAAGAAGGGG - Intergenic
1136031077 16:27503559-27503581 GGGGCTCTTGAGTTCAGAACAGG + Intronic
1140209392 16:72958904-72958926 GGGGGTCTTCAGTACCGAGCTGG + Exonic
1143220331 17:5256095-5256117 AGGGGTCTTCAGCCCAGATCTGG + Intergenic
1149983075 17:61326781-61326803 ATGGGTCTTCAGCACAGAAGAGG + Intronic
1150143648 17:62750495-62750517 GGGTGTATTCAACACAGAACAGG + Intronic
1151156583 17:72127982-72128004 GGGGGACTGCTGTACAGACCAGG - Intergenic
1151448889 17:74185343-74185365 GGGAGTCCTGGGTACAGAACGGG - Intergenic
1153405870 18:4738674-4738696 GGGGGATATCAGTACAGAAATGG - Intergenic
1155024545 18:21929364-21929386 TGGACTCTTCAGTACAGACCAGG - Intergenic
1156279749 18:35625291-35625313 AGGGGTCTTGAGAACAGATCCGG + Intronic
1157526827 18:48389655-48389677 TGGGGTCTTCAGTAATGAGCAGG - Intronic
1157692367 18:49694123-49694145 CTGGGTCCCCAGTACAGAACTGG + Intergenic
1160325014 18:77938021-77938043 GAGGTTCTTCAGACCAGAACTGG + Intergenic
1161590500 19:5127188-5127210 GAGGGGCTTCAGGACAGAGCAGG - Intronic
925141748 2:1555352-1555374 GGGGTTCTTGCGTACAGAATGGG - Intergenic
925185611 2:1844211-1844233 GGGGGTGTTCAGTGCTGAAGGGG - Intronic
925834897 2:7934977-7934999 GAGGGCCTTCAGTGCAGAAGGGG + Intergenic
927974669 2:27329176-27329198 GCGCTTCTTGAGTACAGAACTGG - Exonic
931683456 2:64771614-64771636 CAGGGTCTTCAGCACAGAAAAGG - Intergenic
933642862 2:84782757-84782779 GGAGGTCTTCAGTACTGGTCAGG + Intronic
935717930 2:105954916-105954938 GGGGGGCCTCAGCACAGCACAGG - Intergenic
942643684 2:178088023-178088045 GGGGAGCTTCAGTGCAGAAAAGG - Intronic
943488974 2:188525676-188525698 GGGGATCTTCAGTCTAAAACTGG - Intronic
946038129 2:216760567-216760589 GAGAGACTTCAGTAGAGAACTGG + Intergenic
946706715 2:222465535-222465557 GTGGCTTTTCAGTTCAGAACTGG + Intronic
947134512 2:226963880-226963902 GGGGGTGGTGAGTACAGAATAGG - Intronic
948398559 2:237665785-237665807 GAGGGTCTTCAGAACAGTAAGGG - Intronic
1168782248 20:502984-503006 GTGGGTCTACAGTTCAGAAGAGG - Intronic
1172860886 20:38050422-38050444 GGAGGTCTTCAGTACAGCTTTGG + Intronic
1180856965 22:19053541-19053563 GGAGGTCTTTAGTACAGTGCAGG - Intronic
1182481893 22:30614550-30614572 GGAGGTCATCAGTGCAGACCTGG - Intronic
1183991914 22:41602720-41602742 GGGGCACATCAGGACAGAACGGG + Intronic
952393203 3:32898544-32898566 TTGGGTCTTCACTACAGTACAGG + Intergenic
952584866 3:34879275-34879297 GGTGGTCTGCAGAACACAACTGG + Intergenic
954221112 3:49154494-49154516 GGGGATCCTCACTACAGAAGTGG - Intergenic
955671565 3:61408311-61408333 GGGATTCTTCAGCACAGAGCGGG - Intergenic
955937208 3:64113214-64113236 GGGTGTCTGCAGTGCAGCACGGG + Intronic
957968237 3:87349049-87349071 GGGGTTCTTCAGCACAGCCCAGG - Intergenic
962663066 3:137624736-137624758 GGGAGTCATCAGCACAGAGCTGG - Intergenic
964309502 3:155377484-155377506 AGGGCTCCTCAGTACAAAACTGG + Intronic
966816851 3:183896573-183896595 GGGAGTCTTCAGGACAAAGCTGG - Intergenic
969576703 4:8040246-8040268 GGGGGTGCTCAGCACAGAGCAGG + Intronic
969964269 4:10977948-10977970 GAGGGTCCTCAGGAGAGAACAGG - Intergenic
975621925 4:76305223-76305245 GAGGGTCTTGAGCAGAGAACTGG + Intronic
976578277 4:86702154-86702176 GGGAGGCTTCAGTAAATAACTGG + Intronic
981105163 4:140872905-140872927 GGAAGTCTTCAGTACAGAGAAGG + Intronic
981765022 4:148239375-148239397 TGGAGTCTTCAGTTCAGCACTGG + Intronic
983565810 4:169150634-169150656 GGGGGTCTTCTCTACAAAGCTGG + Intronic
984096541 4:175442091-175442113 TGAGGTCCTCAGTACAGAGCAGG - Intergenic
985518698 5:360196-360218 GGGGGTGTTCAGCACAGAGAGGG - Intronic
986093289 5:4532407-4532429 GGGGGTCTTCAGTAAAGAGAAGG - Intergenic
988501114 5:31784566-31784588 GGGGGTGGTCAGTGCAAAACAGG + Intronic
990891589 5:60656501-60656523 GGGGGACTTCAGTACTCCACTGG - Intronic
991949571 5:71934134-71934156 GGGGGTGTTTAGTCCAGACCTGG + Intergenic
996562547 5:124846347-124846369 TGGGGTCTTCATTTCAGAGCTGG + Intergenic
996623879 5:125545224-125545246 GAGGGTCTTCAGAAGAGAAAAGG + Intergenic
996776905 5:127142741-127142763 GGGGGCCTTAAGTAAAGATCCGG - Intergenic
1001034402 5:168287205-168287227 GGGGGTCTTGTGGACAGCACTGG + Intergenic
1003215047 6:4101477-4101499 AGGGGGCTTCGGTACAGGACAGG + Intronic
1004732141 6:18368281-18368303 GGGGGGCTTCATCACAGACCTGG - Intergenic
1014783451 6:125591077-125591099 GGGTTTCTTCAGCACAGAAATGG - Intergenic
1015653352 6:135488763-135488785 GGGAGTCCTATGTACAGAACAGG - Intronic
1018027862 6:159819729-159819751 GGGGGTCTTCATTAGAGACTTGG + Intronic
1018894497 6:168004258-168004280 GGGAGGCCTCAGAACAGAACGGG + Intronic
1020994556 7:15246635-15246657 TTGGGTCTTCAGTACAGGAGAGG - Intronic
1022120431 7:27303001-27303023 GGGGGTCTTCAGTGCCCATCAGG + Intergenic
1032869028 7:135960909-135960931 GGGTGTCTTAAGAAGAGAACAGG + Intronic
1034935786 7:155199798-155199820 AGGGGTCATCAGCACAGACCCGG - Intergenic
1038798645 8:30730334-30730356 GTGGCTTTTCAGTACAGGACGGG - Intergenic
1040894668 8:52353822-52353844 GGGAGTCTTAAGTACAGCAGAGG - Intronic
1041209902 8:55538725-55538747 GGTGATCATGAGTACAGAACTGG - Exonic
1042526914 8:69773247-69773269 GGGTGACGGCAGTACAGAACTGG + Intronic
1043679118 8:82999196-82999218 GGGGGACTTCAGTACTCCACTGG + Intergenic
1047179403 8:122572843-122572865 GGGGATCTGGAGTACAGAAAGGG + Intergenic
1056620765 9:88211901-88211923 GGGAGTCCTCAGGACAGGACAGG + Intergenic
1057447358 9:95126719-95126741 GGGCGTTTTCAGTACAGCAGTGG - Intronic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1060999558 9:127895478-127895500 GGATGGCTCCAGTACAGAACTGG - Intronic
1062364230 9:136201440-136201462 GGGGGCCTGCAGTACCGAAGTGG - Intronic
1187479222 X:19639693-19639715 GAGGGGCTTCAGTACATGACAGG + Intronic
1188650025 X:32621141-32621163 GGGGGCCTTTAGTGCAGTACTGG + Intronic
1191764969 X:64688140-64688162 AAGAGACTTCAGTACAGAACTGG - Intergenic
1197600857 X:128527526-128527548 GGGGGACTTCAGTACTCCACTGG + Intergenic
1197730564 X:129805897-129805919 TGGGGTCTTCAGGACTGAAGAGG - Exonic
1198434219 X:136599529-136599551 GGGGGGTATGAGTACAGAACTGG + Intergenic