ID: 1122767630

View in Genome Browser
Species Human (GRCh38)
Location 14:104082788-104082810
Sequence CCCACTGACCTGGGCACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122767624_1122767630 -6 Left 1122767624 14:104082771-104082793 CCTCTGAGTGCTCTCGCCCCACT No data
Right 1122767630 14:104082788-104082810 CCCACTGACCTGGGCACTGTGGG No data
1122767620_1122767630 0 Left 1122767620 14:104082765-104082787 CCCCTCCCTCTGAGTGCTCTCGC No data
Right 1122767630 14:104082788-104082810 CCCACTGACCTGGGCACTGTGGG No data
1122767619_1122767630 21 Left 1122767619 14:104082744-104082766 CCACAGTCACTCAGCGGGCATCC No data
Right 1122767630 14:104082788-104082810 CCCACTGACCTGGGCACTGTGGG No data
1122767623_1122767630 -5 Left 1122767623 14:104082770-104082792 CCCTCTGAGTGCTCTCGCCCCAC No data
Right 1122767630 14:104082788-104082810 CCCACTGACCTGGGCACTGTGGG No data
1122767622_1122767630 -2 Left 1122767622 14:104082767-104082789 CCTCCCTCTGAGTGCTCTCGCCC No data
Right 1122767630 14:104082788-104082810 CCCACTGACCTGGGCACTGTGGG No data
1122767621_1122767630 -1 Left 1122767621 14:104082766-104082788 CCCTCCCTCTGAGTGCTCTCGCC No data
Right 1122767630 14:104082788-104082810 CCCACTGACCTGGGCACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122767630 Original CRISPR CCCACTGACCTGGGCACTGT GGG Intergenic
No off target data available for this crispr