ID: 1122767740

View in Genome Browser
Species Human (GRCh38)
Location 14:104083402-104083424
Sequence CATGGTGCTCACAGGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122767736_1122767740 -9 Left 1122767736 14:104083388-104083410 CCGAAAGGGCCAGACATGGTGCT No data
Right 1122767740 14:104083402-104083424 CATGGTGCTCACAGGGATGCAGG No data
1122767735_1122767740 -8 Left 1122767735 14:104083387-104083409 CCCGAAAGGGCCAGACATGGTGC No data
Right 1122767740 14:104083402-104083424 CATGGTGCTCACAGGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122767740 Original CRISPR CATGGTGCTCACAGGGATGC AGG Intergenic
No off target data available for this crispr