ID: 1122769223

View in Genome Browser
Species Human (GRCh38)
Location 14:104090475-104090497
Sequence CTGGAGGCCGAGGCCTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 771
Summary {0: 1, 1: 0, 2: 1, 3: 56, 4: 713}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122769215_1122769223 22 Left 1122769215 14:104090430-104090452 CCACTGTGCCGGGCGGCTGAACA 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1122769223 14:104090475-104090497 CTGGAGGCCGAGGCCTGAGAGGG 0: 1
1: 0
2: 1
3: 56
4: 713
1122769213_1122769223 29 Left 1122769213 14:104090423-104090445 CCTGTGGCCACTGTGCCGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1122769223 14:104090475-104090497 CTGGAGGCCGAGGCCTGAGAGGG 0: 1
1: 0
2: 1
3: 56
4: 713
1122769216_1122769223 14 Left 1122769216 14:104090438-104090460 CCGGGCGGCTGAACATCACAGAA 0: 1
1: 0
2: 1
3: 7
4: 82
Right 1122769223 14:104090475-104090497 CTGGAGGCCGAGGCCTGAGAGGG 0: 1
1: 0
2: 1
3: 56
4: 713

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122769223 Original CRISPR CTGGAGGCCGAGGCCTGAGA GGG Intronic
900100487 1:960212-960234 CAGGAGGGCGAGGCCTGTGGGGG + Intergenic
900480323 1:2895042-2895064 CGGGCGGCAGAGGCCTGGGATGG - Intergenic
900621937 1:3591583-3591605 CTGGAGCCTGAGGCCTGATGGGG + Intronic
900938332 1:5781131-5781153 CTGGAGGAGGAGGCATGAGCAGG + Intergenic
900941152 1:5799402-5799424 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
901234072 1:7658102-7658124 CTGAAGGCCGAAGCCAGAGGTGG + Intronic
901449484 1:9327161-9327183 GTGGAGGCCGTGGGCTTAGAGGG - Intronic
901879878 1:12187603-12187625 CAGGAAACCGAGGCCTGAGAGGG - Intronic
902071545 1:13743292-13743314 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
902448983 1:16484854-16484876 CTGGAGACAGAGGACGGAGAGGG - Intergenic
902451367 1:16498945-16498967 CAGGAGGCCGAGGCCTGCCCGGG - Intergenic
902614399 1:17616003-17616025 CTGCAGGCCGAGGCCTGGGGAGG + Intronic
902918568 1:19653179-19653201 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
903182988 1:21614482-21614504 CTGGGTGCCCAGCCCTGAGAAGG - Intronic
903206317 1:21784883-21784905 CTGGAGGCTGAGGCAGGAGAAGG + Intergenic
903275417 1:22218332-22218354 CTGGTGGCCGAGGTCAGAGAGGG + Intergenic
903550840 1:24156661-24156683 CAGGAGGCTGAGCCCTGGGATGG + Exonic
903643968 1:24879679-24879701 ATGGGGGCAGAGTCCTGAGATGG + Intergenic
903767918 1:25746739-25746761 CAGGAGGCCAAGGCCTGGGTGGG + Exonic
903773214 1:25777223-25777245 GTGGAGGCAGAGGCCTGGAAGGG + Intronic
904186733 1:28711178-28711200 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
904686761 1:32266390-32266412 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
905130015 1:35747214-35747236 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
905470727 1:38189772-38189794 CAGGAGGCAGAAGTCTGAGATGG + Intergenic
905670094 1:39785725-39785747 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
906398221 1:45485291-45485313 CAGGAGGCGGAGGCAGGAGAAGG - Intronic
907319721 1:53594747-53594769 CTGGAGGCCCAGGCCAGAGCTGG + Exonic
907644969 1:56233169-56233191 ATGGAGGCTGAGGCCTAAGGCGG - Intergenic
908085718 1:60631610-60631632 CTAGAGACCGAGACCTCAGAAGG - Intergenic
909128987 1:71711237-71711259 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
909631450 1:77773350-77773372 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
909931772 1:81505247-81505269 CTGCAGGCTGAGGCCAGAGGAGG - Intronic
910029868 1:82706041-82706063 CCGGAGGCTGAGGCAGGAGAAGG + Intergenic
910585028 1:88870031-88870053 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
910651504 1:89573192-89573214 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
910685742 1:89914325-89914347 GTGGAGGCAGAGGCGTGAGCGGG - Intronic
910759228 1:90718604-90718626 CGGGAGGCGGATCCCTGAGAGGG + Intergenic
912853674 1:113148554-113148576 CGGGAGGCTGAGGCAGGAGATGG - Intergenic
913203981 1:116518634-116518656 CAGGAGGCAGAGGCATGAGCTGG - Intronic
913936799 1:125063460-125063482 CTGGAAGACGAGGCCTGTCACGG + Intergenic
913989411 1:143596636-143596658 CTGGAAGCCCAGACATGAGATGG - Intergenic
914734390 1:150401747-150401769 CAGGAGGCTGAGGCAGGAGAAGG - Intronic
914754118 1:150553417-150553439 CTCGAAGCCGGGACCTGAGAAGG - Exonic
914911125 1:151787881-151787903 CAGGAGGCCGAGGTGGGAGATGG + Intronic
915227787 1:154423503-154423525 CAGGAGGCAGAGGGCTGAGTGGG + Intronic
915362976 1:155296844-155296866 ATGGAGGCCAACGCCTGAGTGGG - Intronic
915472639 1:156135120-156135142 GTGGAGGCACAGGCCTGAGTTGG - Intronic
915517079 1:156419943-156419965 CTGGAGGGAGAGGCCTGGGCCGG + Intronic
916139302 1:161680014-161680036 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
916568475 1:166004158-166004180 CTGGAGGCTGAGGCAGGAGAAGG + Intergenic
916822371 1:168411779-168411801 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
919174329 1:194001025-194001047 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
920672915 1:208018231-208018253 CTGGAGGCAGAGGGCACAGAAGG - Intergenic
920722340 1:208399501-208399523 CAGGAGGCTGAGGCCGGAGAAGG + Intergenic
920976404 1:210790025-210790047 CAGGAGGCTGAGGCCTCAGAAGG - Intronic
922108580 1:222534469-222534491 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
922211127 1:223487618-223487640 CTGGAGCCTGGGGCCTGGGAAGG - Intergenic
922227340 1:223656787-223656809 CAGGAGGCTGAGGCAGGAGAAGG - Intronic
922319690 1:224475248-224475270 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
922880267 1:228975394-228975416 CTGGAAGCTGAGGCCAGGGAAGG - Intergenic
923131356 1:231077393-231077415 ATGGAGGCTGAGCCATGAGATGG + Intergenic
923454732 1:234153955-234153977 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
923575405 1:235154138-235154160 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
923746372 1:236704490-236704512 CTGGAGGCCTGGACTTGAGATGG - Intronic
924081685 1:240405510-240405532 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
924329493 1:242927745-242927767 CAGGAGGCTGAGGCAGGAGATGG + Intergenic
924592234 1:245414555-245414577 CTGGGTGCCGAGGCCTGGGGAGG - Intronic
924691040 1:246350723-246350745 CTGGAGACGGAGTCTTGAGAAGG + Intronic
924823617 1:247518145-247518167 CAGGAGCCAGAGGCCTCAGAGGG - Intronic
924948276 1:248860446-248860468 CTGGAGGCCAAGGCATCAGCAGG + Intergenic
1063549951 10:7022043-7022065 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1063719011 10:8559728-8559750 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1064026904 10:11856266-11856288 CTGGAGACACAGGCCTTAGAGGG - Intronic
1064211370 10:13363012-13363034 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
1064682786 10:17828180-17828202 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1064785604 10:18891170-18891192 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1065692603 10:28350870-28350892 CAGGAGGCGGAGGCAGGAGAAGG - Intergenic
1066681671 10:37941145-37941167 CTGGAGGCGGTGGACTGAGCTGG - Intergenic
1067118543 10:43455112-43455134 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1067409202 10:46049972-46049994 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1067892455 10:50148701-50148723 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1068213216 10:53949630-53949652 TAGGAGGCTGAGGGCTGAGATGG + Intronic
1068949161 10:62760242-62760264 CTGGAGGCCAAGGTCCTAGAAGG + Intergenic
1069433726 10:68360640-68360662 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
1069631299 10:69898419-69898441 CTGGAGGCCGAGGCCGGGTGTGG + Intronic
1069658786 10:70109666-70109688 CTGGAGCCAGAGGTCGGAGATGG - Intronic
1070160605 10:73864746-73864768 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1070290790 10:75111937-75111959 GTGGAGGCCGAGGAACGAGAGGG + Intronic
1070735542 10:78861469-78861491 CTGGAGCCCAAGGCATGATAGGG + Intergenic
1070981907 10:80655172-80655194 CTGCAGGCTGAGCCCTGAGAAGG - Intergenic
1071122138 10:82290737-82290759 CGGGAGGCTGAGGCAGGAGATGG - Intronic
1071414515 10:85428698-85428720 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1072821524 10:98562607-98562629 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1073369308 10:102972529-102972551 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1073432917 10:103498330-103498352 CGGGAGGCTGAGGCGGGAGAAGG - Intronic
1073778833 10:106815063-106815085 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1073834501 10:107425649-107425671 CTGGAGGCGAAGGCCTGTGATGG - Intergenic
1075033190 10:119040898-119040920 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
1075176053 10:120162304-120162326 CTGGAGGGCAAGGCCTGTGTGGG + Intergenic
1076081169 10:127581821-127581843 CGGGAGGCTGAGGCAAGAGAGGG + Intergenic
1076405362 10:130208762-130208784 CTGCAGGCCCAGGAGTGAGAAGG + Intergenic
1076474038 10:130740075-130740097 CTGGAGGCCGAGAGCAGAGAGGG + Intergenic
1076481269 10:130786638-130786660 CTGCAGGCCGAGGGCTGGGAAGG + Intergenic
1076850596 10:133090656-133090678 CTGGAGGCCGTGGCCAGGGCAGG + Intronic
1076901646 10:133341816-133341838 ATGGAGGCTGACGTCTGAGACGG + Intronic
1077208624 11:1357443-1357465 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1077678531 11:4219026-4219048 CTGGAGGTCAGGGCCTGAGGAGG - Intergenic
1077682099 11:4251306-4251328 CTGGAGGTCAGGGCCTGAGGAGG + Intergenic
1077687934 11:4315429-4315451 CTGGAGGTCAGGGCCTGAGGAGG - Intergenic
1078845143 11:15113715-15113737 CTGGGGGCCCAGGGCTCAGAAGG - Intronic
1079051933 11:17168473-17168495 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1079285719 11:19129980-19130002 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1080541241 11:33267599-33267621 CAGGAGGCCAAGGCGGGAGAAGG - Intronic
1081670351 11:44938979-44939001 CGGGAGGGCAAGGCCTGAGCAGG - Intronic
1081979014 11:47254624-47254646 CTGGAGGCAGAAGTCTGAGATGG + Intronic
1083233874 11:61339701-61339723 CAGGAGGGCGGGGTCTGAGAAGG - Intronic
1083240868 11:61387372-61387394 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1083277060 11:61602883-61602905 CAGGAGCCCCAGGCCTCAGATGG + Intergenic
1083281977 11:61632537-61632559 TTGGTGGCTGAGGCCTGGGAGGG - Intergenic
1083631522 11:64097812-64097834 CTGCAGCCCCAGGCCTGAGCAGG - Intronic
1083912525 11:65718638-65718660 TAGGAGGCCAAGGTCTGAGAGGG - Exonic
1083935842 11:65869754-65869776 CAGGAGGCGGAGGCCTCAAATGG + Intronic
1084068835 11:66720804-66720826 CCGGGGGCTGAGGCCAGAGAGGG + Intronic
1084550534 11:69839087-69839109 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1084582413 11:70032276-70032298 CTGCAGGCCCAGGGCTGGGAAGG + Intergenic
1084960496 11:72713739-72713761 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1085261089 11:75205124-75205146 CTGGAGGCAGAGCACTGAGCTGG + Exonic
1086209502 11:84301551-84301573 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1086435425 11:86775295-86775317 CTGGAGGCAGAAGCCTAACATGG - Intergenic
1087446025 11:98254262-98254284 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1088061175 11:105653015-105653037 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1088468789 11:110172235-110172257 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1088883124 11:113987113-113987135 CTGGAGGGCGTGGCCTGCCAAGG + Intronic
1089440082 11:118507855-118507877 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
1089496041 11:118909193-118909215 CTGGAGGGGAAGGCCTGAGGAGG + Intronic
1089659037 11:119974009-119974031 CTGGAGGCCTTGGCTTGAGCAGG + Intergenic
1089944234 11:122451345-122451367 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1090409027 11:126495081-126495103 CTGGAGGTCAGGGCCTAAGAGGG - Intronic
1091298572 11:134490219-134490241 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091298583 11:134490260-134490282 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091298594 11:134490301-134490323 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091298605 11:134490342-134490364 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091432081 12:444932-444954 CTGGTTGCCAAGGGCTGAGAAGG + Intergenic
1091657095 12:2353756-2353778 GTGCAGGCCCAGGGCTGAGATGG + Intronic
1092133821 12:6132047-6132069 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
1092528354 12:9324534-9324556 CCGGAGGCGGTGGCCTGAGCTGG + Intergenic
1093006158 12:14053557-14053579 CTTGAGGCCTAGGCTTGGGAGGG - Intergenic
1093333617 12:17873709-17873731 CGGGAGGCTGAGGCGGGAGAAGG - Intergenic
1094682271 12:32677425-32677447 CAGGAGGCTGAGGCAGGAGACGG - Intergenic
1095755862 12:45766617-45766639 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1095928368 12:47602171-47602193 CGGGAGGCTGAGGCAGGAGATGG + Intergenic
1096119414 12:49077856-49077878 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1096340437 12:50794054-50794076 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1096386648 12:51198935-51198957 CTGGAGGCCCAAACCTGAGGGGG + Intronic
1096478194 12:51921335-51921357 CTAGAGGCTGAGGCCTGGCAGGG - Intronic
1096529325 12:52233343-52233365 CTGGGCGCCGCGGCCCGAGAAGG - Exonic
1096968372 12:55646701-55646723 CTGGAGGACGGGGCCAGAGGAGG + Intergenic
1096991867 12:55810969-55810991 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1097219497 12:57439424-57439446 GTAGAGGCCAAGGGCTGAGAGGG - Intronic
1098468661 12:70819213-70819235 CCGGAGGCTGAGGCATGAGGAGG + Intronic
1098494370 12:71117547-71117569 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1098588631 12:72185034-72185056 CTGGAGGGAGAGGCTTGAGCGGG + Intronic
1098617987 12:72553951-72553973 CAGGAGGCTGAGGCAGGAGATGG - Intronic
1098702666 12:73648416-73648438 CGGGAGGCTGAGGCAGGAGATGG + Intergenic
1099973533 12:89524714-89524736 CCGGAGGCCGAGGACCGAGAGGG - Exonic
1100503670 12:95198543-95198565 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1100581269 12:95942761-95942783 CTGGAGGCAGAGCCCCGGGAGGG - Exonic
1101006943 12:100410387-100410409 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
1102006151 12:109590474-109590496 CTTGGGGCCGGGGCCAGAGAGGG - Intronic
1102472600 12:113168046-113168068 CTGGAGGTGGAGGCCTCAGTCGG - Intronic
1102681745 12:114695140-114695162 CTGGAGGCTGGGGCAGGAGAGGG + Intergenic
1103207149 12:119138867-119138889 ATGGAGGGTGAGGGCTGAGATGG + Intronic
1103539489 12:121655923-121655945 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1103577954 12:121892593-121892615 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1103809330 12:123601406-123601428 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1103814173 12:123639962-123639984 CGGGAGGCTGAGGCATGAGATGG - Intronic
1103964567 12:124630597-124630619 TTGGAGGGTCAGGCCTGAGAGGG - Intergenic
1103972427 12:124680490-124680512 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1104234943 12:126924746-126924768 CGGGAGGCTGAGGCGGGAGAAGG + Intergenic
1104549726 12:129745447-129745469 CTGGAGGCCTGGTCATGAGAAGG - Intronic
1104637997 12:130449924-130449946 CTGGAGGCAGAAGTTTGAGATGG - Intronic
1104850559 12:131871504-131871526 AGGGAGGCCGAGGCAGGAGAAGG + Intergenic
1104859029 12:131915238-131915260 CTGCAGGCTGGGGCCTGGGAAGG + Intronic
1105062774 12:133169034-133169056 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
1106304020 13:28494746-28494768 CTGGGGGCCGGGGCCTGAGGCGG - Intronic
1107233220 13:38136680-38136702 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1107321976 13:39199426-39199448 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1108086923 13:46803490-46803512 CTGGAGGCCTAGACTTGCGACGG - Intergenic
1108224550 13:48274810-48274832 CATGAGGCTCAGGCCTGAGAGGG + Intergenic
1108550133 13:51535710-51535732 CGGGAGGCTGAGGCACGAGAAGG + Intergenic
1108649539 13:52463041-52463063 CTGGAGGCTGAGGCAGGAGAAGG - Intronic
1108684788 13:52809426-52809448 CTGGGGGTCGGGGCCTGGGAGGG + Intergenic
1109496971 13:63184900-63184922 CTGGAGCTAGATGCCTGAGATGG - Intergenic
1110031949 13:70627171-70627193 CTGGAGGCTGAGGCAGGAGAAGG - Intergenic
1110185644 13:72671869-72671891 CGGGAGGCTGAGGCAAGAGAAGG - Intergenic
1110341039 13:74390375-74390397 GTGGAGGGCGAGGCATGGGAGGG - Intergenic
1110772740 13:79368128-79368150 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1110994996 13:82096697-82096719 CTGGAGGCTGAGACAGGAGAAGG + Intergenic
1111361343 13:87181904-87181926 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1111689065 13:91538686-91538708 CAGGAGGCTGAGGCAAGAGAAGG - Intronic
1112287860 13:98119715-98119737 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1112509709 13:99998096-99998118 GGGGAGGCCGAGGCCAGAAAGGG + Intergenic
1112558888 13:100494081-100494103 CAGGAGGCTGAGGCGGGAGAAGG + Intronic
1112958565 13:105092411-105092433 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1113071059 13:106422089-106422111 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1113102743 13:106737581-106737603 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1113154645 13:107305839-107305861 CTGGAGGTTGAGGACTGAGAGGG + Intronic
1113780355 13:112973187-112973209 CCGAAGGCAGAGGCGTGAGAGGG - Intronic
1114130488 14:19786108-19786130 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1115291059 14:31773421-31773443 CTGGAGGGAGAGTCCAGAGATGG + Intronic
1115649920 14:35395703-35395725 CCGGAGGCTGAGGCAGGAGAAGG + Intergenic
1116206708 14:41876384-41876406 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1116911701 14:50473827-50473849 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1116925056 14:50625802-50625824 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
1117259820 14:54020416-54020438 CTCGAGGGGGAAGCCTGAGAGGG + Intergenic
1117414338 14:55479907-55479929 CTGGAGAGAGAGGCCAGAGAAGG + Intergenic
1117491912 14:56256328-56256350 CTGGAGGCTGAGGTGGGAGAAGG + Intronic
1117741772 14:58826252-58826274 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1118245534 14:64106541-64106563 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1120364256 14:83545624-83545646 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1120593396 14:86404022-86404044 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1120765492 14:88323770-88323792 CCGGAGGCCGAGGTCTGCGGCGG - Intronic
1121001423 14:90454374-90454396 TTGGAGGCTGAGGACTGAGCCGG - Intergenic
1121570382 14:94942593-94942615 ATGTAGGCTGAGACCTGAGATGG - Intergenic
1121617622 14:95323328-95323350 CTTGAGGCCGTGACCAGAGAAGG - Intergenic
1121656103 14:95597035-95597057 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1121991977 14:98567085-98567107 CAGGAGGCAGAGGCTAGAGATGG - Intergenic
1122134787 14:99626615-99626637 CTGTAGACACAGGCCTGAGAAGG + Intergenic
1122288740 14:100668151-100668173 CTGGGGTCGGAGGCATGAGAAGG + Intergenic
1122398508 14:101452134-101452156 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
1122510784 14:102265524-102265546 CGGGAGGCTGAGGCAGGAGATGG + Intronic
1122593206 14:102870479-102870501 GGTGAGGCCGAGGGCTGAGAAGG - Intronic
1122769223 14:104090475-104090497 CTGGAGGCCGAGGCCTGAGAGGG + Intronic
1122918814 14:104871222-104871244 CTGGAAGCCGAGGACAGAGCAGG - Intronic
1123067341 14:105625316-105625338 CTGGAGGGCGAGGCCTGGGTTGG + Intergenic
1123071360 14:105644040-105644062 CTGGAGGGCGAGGCCTGGGCTGG + Intergenic
1123076320 14:105669083-105669105 CTGGAGGGCGAGGCCTGGGCTGG + Intergenic
1123091020 14:105742313-105742335 CTGGAGGGCGAGGCCTGGGCTGG + Intergenic
1123096654 14:105770077-105770099 CTGGAGGGCGAGGCCTGGGCTGG + Intergenic
1123096701 14:105770265-105770287 CTGGAGGGCGAGGCCTGGGCTGG + Intergenic
1123096747 14:105770453-105770475 CTGGAGGGCGAGGCCTGGGCTGG + Intergenic
1123096794 14:105770641-105770663 CTGGAGGGCGAGGCCTGGGCTGG + Intergenic
1125091363 15:35796465-35796487 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
1125264204 15:37861124-37861146 TTGGAGGCTGAGGGCTGAGGTGG - Intergenic
1125639213 15:41215578-41215600 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1125809477 15:42525260-42525282 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1126076755 15:44918891-44918913 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1126082837 15:44982601-44982623 CCGGAGGCTGAGGCAGGAGAAGG - Intergenic
1126171968 15:45702461-45702483 GTGGAGGCGGAGGCCTGGGCTGG - Intergenic
1127119498 15:55758786-55758808 CTGCAGGCTGAGGCCTAAAATGG - Intergenic
1128165879 15:65464255-65464277 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1128787996 15:70412457-70412479 CTGGAGGCTCATGCCTGAGATGG + Intergenic
1129295433 15:74597552-74597574 CTGCAGGCTGAGGCCAGAGGAGG - Exonic
1129365052 15:75049042-75049064 CCAGAGCCCAAGGCCTGAGAGGG - Intronic
1129634805 15:77304551-77304573 CGGGAGGCTGAGGCAGGAGATGG - Intronic
1129814638 15:78540745-78540767 CTGGACGCCGGGGCCCGCGAGGG + Intronic
1130162320 15:81413990-81414012 CTGGGAGCCGAGGCCGGAGCCGG + Intergenic
1130370589 15:83283397-83283419 CTGGGGGCCGCGGGCGGAGAAGG - Intronic
1130651602 15:85765080-85765102 CTGGAGGCTCAGACCAGAGATGG + Intronic
1131390299 15:92042629-92042651 ATGGAGGTGGAGGTCTGAGAAGG + Intronic
1131722330 15:95183937-95183959 CGGGAGGCTGAGGCAGGAGATGG - Intergenic
1131976082 15:97947128-97947150 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1131990745 15:98090244-98090266 CCGGAGGCTGAGGCAGGAGAAGG + Intergenic
1132099381 15:99013032-99013054 CCGGAGGCTGAGGCAGGAGAAGG - Intergenic
1132136612 15:99347313-99347335 CGGGAGGCTGAGGCAAGAGAAGG - Intronic
1132182481 15:99769113-99769135 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1132182987 15:99776329-99776351 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1132309743 15:100848857-100848879 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1132465931 16:77514-77536 CTAGAGGCCGAGGCCAGACCAGG - Intronic
1132687599 16:1168798-1168820 CTGGAGCCTGAGGCCCGAGGAGG + Intronic
1132713193 16:1278319-1278341 GTGGGGGCCCAGGCCAGAGAGGG - Intergenic
1132975697 16:2710129-2710151 CTGGAGCCCAAGGTCTGAGGAGG - Intergenic
1133491593 16:6275203-6275225 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1133494586 16:6304777-6304799 CAGGAGGCTGAGGCCGGAGAAGG + Intronic
1133895492 16:9924019-9924041 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
1134031406 16:10995378-10995400 CTGGCGCCTGAGGCCGGAGATGG + Intronic
1134047869 16:11114574-11114596 CTGCAGGCAGAGGCTTTAGAGGG + Intronic
1134670960 16:16054690-16054712 CTGGAGGCCAGGGACTGAAATGG - Intronic
1135087893 16:19489438-19489460 CAGGAGGCTGAGGCAGGAGAAGG - Intronic
1135462659 16:22658749-22658771 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
1136133304 16:28238534-28238556 TGGGAGGCCGAGGCTGGAGATGG + Intergenic
1136625850 16:31461839-31461861 CTGGAGAATGTGGCCTGAGAGGG - Intronic
1136867582 16:33769578-33769600 CTGGACGCCATGGCCCGAGATGG + Intergenic
1137559239 16:49492462-49492484 CCGGAGGCCGAGGCCGGGGCCGG + Intronic
1138616155 16:58169030-58169052 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1139096505 16:63710844-63710866 CTGGAGGCTGAGGCTTGAACTGG + Intergenic
1139195763 16:64917207-64917229 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1139478843 16:67217118-67217140 CTGGAGGCCAGGACCTGATAAGG - Intronic
1139831457 16:69801650-69801672 CCGGAGGCTGAGGCAGGAGATGG - Intronic
1140496490 16:75393623-75393645 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1140673610 16:77303922-77303944 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1141067574 16:80926717-80926739 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1142304728 16:89278831-89278853 CAGGAGACCGAGGCCTGGCACGG + Intronic
1142311665 16:89317683-89317705 CTGGAGCCTGAGGCCCGAGGGGG - Intronic
1142422307 16:89979389-89979411 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1203104579 16_KI270728v1_random:1346625-1346647 CTGGACGCCATGGCCCGAGACGG - Intergenic
1203128935 16_KI270728v1_random:1615743-1615765 CTGGACGCCATGGCCCGAGACGG + Intergenic
1142610076 17:1104321-1104343 GTGGAGGACCAGGCCTGAGCTGG - Intronic
1142696005 17:1634281-1634303 CGGGAGGCTGAGGCAGGAGAAGG + Exonic
1142702759 17:1674126-1674148 CCGGAGGCTGAGGCTGGAGAAGG - Intronic
1142758546 17:2029832-2029854 CTGCAGGCCGAGTCTTGTGAAGG - Intergenic
1142830671 17:2546654-2546676 CGGGAGGCTGAGGCGGGAGAAGG + Intergenic
1144684489 17:17216846-17216868 CTGACTGCCCAGGCCTGAGAGGG - Intronic
1144799557 17:17916177-17916199 CAGGAGGCTGAGGCAGGAGAAGG - Intronic
1144939255 17:18925997-18926019 CGGGAGGCTGAGGCAGGAGATGG + Intronic
1145181326 17:20755376-20755398 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1146014685 17:29223407-29223429 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1146321594 17:31850999-31851021 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1146482263 17:33214167-33214189 CTGCTGGCAGAGGCCTCAGATGG - Intronic
1146740508 17:35279280-35279302 GTGGAGGGAGAGGCCTGAGCGGG - Intergenic
1147281150 17:39362427-39362449 CGGGAGGCTGAGGCAGGAGATGG - Intronic
1147564296 17:41527306-41527328 GAGGAGGCCAAAGCCTGAGAGGG + Intronic
1147719180 17:42527875-42527897 CTGGAGGCTGAGACAGGAGATGG + Intergenic
1148368838 17:47078318-47078340 TGGGAGGCCGAGGCATGGGAGGG - Intergenic
1148495540 17:48051471-48051493 CTCGAGGGCGAGGCCTGAGTTGG - Exonic
1148991988 17:51674014-51674036 CTGGAGGGTGAAGCCTGAGCAGG - Intronic
1149571265 17:57674050-57674072 CTGGAGGCTGGGGCCAGAGCTGG - Intronic
1150534619 17:66022601-66022623 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
1150620036 17:66801322-66801344 CTGGGGGCAGAGGCCAGGGATGG - Intronic
1151364077 17:73605859-73605881 CAGGAGGCTGAGTCCAGAGAAGG - Intronic
1151559784 17:74864097-74864119 CGGGTGGCAGAGGCCTGGGAAGG + Intronic
1151665712 17:75544117-75544139 CAGGAGTCTGGGGCCTGAGAAGG + Intronic
1151752659 17:76049502-76049524 CTTGAGGCAGAGGACTCAGAAGG + Intronic
1151934625 17:77254411-77254433 CTGAAGGGCGAGACCTGGGAGGG + Intergenic
1151970544 17:77455363-77455385 CCGGGGGCACAGGCCTGAGAAGG - Intronic
1152089717 17:78239844-78239866 AGGGAGGCCTTGGCCTGAGACGG - Exonic
1152174336 17:78777311-78777333 CAGGAGGCTGAGGCAGGAGATGG + Intronic
1152342170 17:79731299-79731321 CTGGACGCCATGGCCCGAGACGG + Exonic
1152573582 17:81130789-81130811 CTGGAGGCCGAGGGCTGTCCTGG + Intronic
1152694667 17:81738164-81738186 CAGGGACCCGAGGCCTGAGACGG + Intergenic
1152943285 17:83184014-83184036 CTGGGGGCTGAGGCCACAGAAGG + Intergenic
1153415160 18:4838308-4838330 CTGGAGGCCCAGACTTGAGATGG - Intergenic
1154231218 18:12557635-12557657 GTGGATGCTGAGGCCTGAGGAGG + Intronic
1154231502 18:12559578-12559600 GTGGACGCCGTGGCCTGAGGAGG + Intronic
1155146062 18:23084696-23084718 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1155155093 18:23151122-23151144 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1155973529 18:32103858-32103880 CGGGAGGCTGAGGCAGGAGATGG + Intronic
1156489890 18:37489809-37489831 CTGAACGCTGAGGCTTGAGAAGG + Intronic
1157410715 18:47460687-47460709 CTGTACCCCGAGGCCTGAGCTGG + Intergenic
1157609666 18:48948750-48948772 CTGGAGTCCGAGGACGGGGAGGG - Intronic
1157738391 18:50070924-50070946 CAGGAGGCTGAGGCCAGAGGAGG - Intronic
1157777389 18:50406361-50406383 CTGGAGGCGGTCGCCTGAGCTGG - Intergenic
1158532132 18:58273011-58273033 CTGTAAGCTGAGGCCTGGGAAGG + Intronic
1159265193 18:66071255-66071277 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1160065580 18:75570991-75571013 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1160188663 18:76696554-76696576 CAGGAGGCTGAGGCAGGAGATGG - Intergenic
1160499372 18:79394637-79394659 CTCCAGGCCGAGGCCTGCGGTGG + Intergenic
1160539371 18:79612003-79612025 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
1160621809 18:80176525-80176547 CTTGAGGCTGAGACCTGAGTGGG - Intronic
1160730282 19:638962-638984 GGGGAAACCGAGGCCTGAGAGGG - Intergenic
1160757409 19:764957-764979 CTGGGGGCCGAGGCCTGCTTTGG - Intergenic
1161159152 19:2752132-2752154 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1161280460 19:3442810-3442832 GTGGAGGCTGAGGCCTGATGGGG - Intronic
1161588910 19:5119831-5119853 CGGGAGGCCGAGGGCGCAGAAGG + Exonic
1161776023 19:6262607-6262629 GAGGAGGCTGAGGCCAGAGAAGG + Intronic
1161936817 19:7377174-7377196 TGGGAGGCTGAGGCCGGAGAAGG - Intronic
1162220811 19:9174639-9174661 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1162335912 19:10060343-10060365 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1162425367 19:10592106-10592128 CCGGAGGCTGAGGCAGGAGAAGG - Intergenic
1162469689 19:10864998-10865020 CTGGAAGCAGAGACCTCAGAGGG - Intronic
1162771763 19:12953516-12953538 CTGGAGGCCAAGGCCAGACTGGG - Exonic
1162928647 19:13944265-13944287 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1162935618 19:13980165-13980187 CAGGAGGCAGAGCCCTGAGCCGG - Intronic
1162964822 19:14150829-14150851 CTGGTGGCCCAGGCCAGGGAGGG - Exonic
1163288088 19:16361798-16361820 CCCGAGGCAGAGGCCTTAGAAGG + Exonic
1163518504 19:17778863-17778885 CTGGAGGCCTTGGCCGGAGGAGG + Exonic
1163660761 19:18575850-18575872 CGGGAGGCTGAGGCAGGAGAAGG - Exonic
1163682868 19:18693585-18693607 CAGGAGGCTGAGGCAGGAGAAGG - Intronic
1163801212 19:19367010-19367032 CTGGTGGCCAAGGCCAGAGCAGG - Intergenic
1164101298 19:22056579-22056601 CGGGAGGCCGAGGCAGGAGAAGG - Intronic
1164641800 19:29831785-29831807 CTGTAGGCAGAGGCCTGGGCAGG - Intergenic
1165008051 19:32822639-32822661 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1165176048 19:33930634-33930656 CTGTAGGCCGGAGGCTGAGAAGG - Intergenic
1165710882 19:38010068-38010090 CTGGAGGGAGAGGGCTGAGCAGG - Intronic
1166729300 19:45049599-45049621 CTGCTGGCTGAGGGCTGAGATGG + Intronic
1166732952 19:45068883-45068905 CAGGAGGCTGAGGCAGGAGATGG + Intronic
1166795032 19:45420712-45420734 CTGGAGGGAGAGGGCTGAGCTGG - Intronic
1166813857 19:45529837-45529859 CTGGAGGCTGAGGCGGGAGGAGG - Intronic
1167167678 19:47810452-47810474 CAGGAGGCTGAGGCAGGAGAAGG - Intronic
1167406289 19:49310718-49310740 CTGGAGGCCTGGGCCCAAGATGG - Intronic
1167694866 19:51009421-51009443 CAGGAGGCAGAAGCCTGGGATGG + Intronic
1168113881 19:54209949-54209971 CATGAGGCTGAGGCCAGAGAGGG + Intronic
1168354972 19:55695224-55695246 CGGGAGGCACAGGACTGAGACGG - Exonic
925149670 2:1606530-1606552 CTGGAGGCTGAGGCTGGAAAGGG + Intergenic
925296047 2:2778200-2778222 CTGGAGACCCAGCGCTGAGAAGG + Intergenic
925534219 2:4899599-4899621 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
925855340 2:8124041-8124063 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
925920576 2:8634991-8635013 GTGGAGGCAGAGGCTGGAGAGGG - Intergenic
926684175 2:15685726-15685748 CCGGAGGCTGAGGCAGGAGAAGG + Intergenic
926880625 2:17540320-17540342 CTGAAGGCCGAGGCCAGAGATGG - Intronic
927125015 2:20006033-20006055 CTGGATGGCTAGGCCTGACATGG + Exonic
927168039 2:20344875-20344897 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
927202586 2:20587638-20587660 CGGGAGGCCGAGGCAGGAGAAGG + Intronic
927896730 2:26787319-26787341 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
928140382 2:28723564-28723586 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
928454148 2:31404165-31404187 CTGGAGTCCGATGGCTGTGATGG - Intronic
928484499 2:31716537-31716559 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
929023557 2:37577483-37577505 CTGGAGGCAGAGGGCAGACATGG - Intergenic
929204364 2:39274320-39274342 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
929501590 2:42494635-42494657 CTGGGGCGCGAGTCCTGAGAAGG + Exonic
929724469 2:44410361-44410383 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
929748412 2:44683715-44683737 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
932330370 2:70895252-70895274 CTGTGGGCCTAGGCCAGAGAAGG + Intergenic
933551788 2:83786944-83786966 CTGCAGACAGAGGCCTGGGAAGG - Intergenic
933795382 2:85915312-85915334 CTGGAGGAGGAGTCCTGAGTGGG + Intergenic
933891230 2:86772347-86772369 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
933974332 2:87496327-87496349 CTGAAGGCAGAGGCCTCAGCAGG - Intergenic
934026182 2:88003281-88003303 GTGGGGACCGAGGCCTGAGGAGG - Intergenic
934779968 2:96963677-96963699 CTGCAGGCCGAGTCCTGTGTGGG + Intronic
935050141 2:99518374-99518396 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
936095903 2:109529801-109529823 CTGGAGGCAGGGCCCTGGGAAGG - Intergenic
936319492 2:111454492-111454514 CTGAAGGCAGAGGCCTCAGCAGG + Intergenic
936432661 2:112478482-112478504 CGGGAGGCTGAGGCAGGAGACGG - Intergenic
936490587 2:112968465-112968487 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
936505151 2:113099838-113099860 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
936587742 2:113773276-113773298 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
937343715 2:121109427-121109449 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
937357473 2:121207093-121207115 CGGGAGGCTGAGGCAGGAGATGG + Intergenic
938079667 2:128362993-128363015 GTGCAGGCAGAGGCCTGAGAAGG + Intergenic
939251963 2:139693147-139693169 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
940105684 2:150097285-150097307 CGGGAGGCTGAGGCATGAGGCGG - Intergenic
940215306 2:151297518-151297540 CTGGAGGCCGAGTCCATAGACGG + Intergenic
942465054 2:176198816-176198838 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
942477548 2:176344151-176344173 TGGGAGGCTGAGGCATGAGAAGG - Intergenic
942561519 2:177224820-177224842 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
942576450 2:177368677-177368699 CAGGAGGCTGAGGCAGGAGAAGG - Intronic
942851752 2:180495368-180495390 CTTGAGGCTGAAGCCAGAGAGGG + Intergenic
942911698 2:181252012-181252034 CCGGAGGCTGAGGCAGGAGATGG - Intergenic
943079369 2:183239192-183239214 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
943256996 2:185607111-185607133 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
944079894 2:195775803-195775825 CTGGATTCTGAGGCCTGGGAAGG - Intronic
944719179 2:202405580-202405602 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
945130758 2:206569588-206569610 ATGGAGGCAGAGTCCTAAGAAGG + Intronic
945693742 2:213076795-213076817 CCGGAGGCTGAGGCAGGAGAAGG + Intronic
945880810 2:215323048-215323070 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
946276817 2:218637819-218637841 AGGGAGGCAGAGGTCTGAGAGGG + Intergenic
946353334 2:219169572-219169594 CTGGAGGCCAGGAGCTGAGAAGG + Exonic
947144734 2:227054601-227054623 CTGGAGACCGGGGACTGAGAGGG - Exonic
947598151 2:231426988-231427010 CTGGAGGCTGAGGGCTCAGCAGG - Intergenic
947717694 2:232350148-232350170 CTGGAGGAGGAGGCCTGTGGAGG + Intergenic
947740759 2:232483821-232483843 CTGGAGGAGGAGGCCTGTGGAGG + Intronic
948490572 2:238310069-238310091 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
948631761 2:239307096-239307118 CTGGAGGGTGTGGCCTGAGATGG - Intronic
948770840 2:240250631-240250653 CTCGAGGCTGAGGACAGAGAAGG + Intergenic
948959585 2:241322499-241322521 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1168955671 20:1832648-1832670 AAGGAGGCTGAGGTCTGAGAGGG + Intergenic
1170612860 20:17928791-17928813 CAGGTGGCCGAGGCCCCAGAAGG + Intergenic
1170817334 20:19724908-19724930 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1171206174 20:23283138-23283160 CAGGAGGCCTAGGCGTGACACGG - Intergenic
1171255969 20:23689208-23689230 ATGGAGGAGGAGGCCTGGGAGGG - Intergenic
1171263317 20:23751105-23751127 ATGGAGGAGGAGGCCTGGGAGGG - Intronic
1172019404 20:31902484-31902506 CAGGAGGCTGAGGCAGGAGAAGG - Intronic
1172176668 20:32976597-32976619 GTGGAGGTGGAGGCCTGGGAGGG + Intergenic
1172490616 20:35333951-35333973 CTGAAGGCCGGGGGCTGGGAAGG + Intronic
1172660996 20:36568698-36568720 CGGGAGGCCGAGGCAGGGGAAGG - Intergenic
1174454460 20:50639497-50639519 CAGGAGGCTGAGGCTCGAGATGG + Intronic
1174648171 20:52103779-52103801 CTCGTGCCCGAGGCCTGGGATGG - Intronic
1175038125 20:56019809-56019831 CTGCATGCCCAGGCCTGAGATGG - Intergenic
1175369991 20:58481730-58481752 CTGGAGGCCGAAGCTGGAGCCGG - Intronic
1175519562 20:59591389-59591411 GTGGAGGCCAAGGCCAGAGCTGG - Intronic
1175958319 20:62622585-62622607 CTGGAGGCAGAGGACTGAACTGG - Intergenic
1176005585 20:62860965-62860987 GTGGAGGCCGAGGCCGGGGCCGG - Intronic
1176430090 21:6570069-6570091 CTGGAGGCCAAGGGCAGAGCGGG - Intergenic
1176510735 21:7745578-7745600 CTGGAAGCCCAGGCCTCGGAGGG - Intronic
1177092901 21:16792137-16792159 CTGGAAGCCGAGGCAAAAGAAGG - Intergenic
1177841659 21:26241200-26241222 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1177957980 21:27624591-27624613 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
1178337869 21:31759884-31759906 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1178644848 21:34376107-34376129 CTGGAAGCCCAGGCCTCGGAGGG - Intronic
1179112830 21:38462084-38462106 CAGGAGGCTGAGGCAGGAGAAGG - Intronic
1179343764 21:40537042-40537064 CTGGAGTCTGAGACCTGAAATGG - Intronic
1179539686 21:42076126-42076148 CTGGAGGCGGTGCCCTAAGATGG + Exonic
1179705484 21:43177531-43177553 CTGGAGGCCAAGGGCAGAGCGGG - Intergenic
1180675103 22:17581335-17581357 CTGGAAGCAGAGGCCAGAGTAGG - Intronic
1180823721 22:18848801-18848823 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
1180863722 22:19103534-19103556 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1180908319 22:19431397-19431419 CGGGAGGCCGAGCCCGGAGTCGG - Intronic
1181029129 22:20141551-20141573 CTGGGGGACGAGGCCTGCCAGGG - Intronic
1181210185 22:21284750-21284772 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
1181645983 22:24232113-24232135 CTGGAGACCGTGGCCACAGAGGG - Exonic
1181664168 22:24379974-24379996 CTGGAGGCTGAGGCAGGAGAAGG - Intronic
1181758006 22:25039071-25039093 ACCCAGGCCGAGGCCTGAGATGG + Exonic
1181770459 22:25121354-25121376 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1182039702 22:27227326-27227348 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1182796963 22:32997919-32997941 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
1182929390 22:34158267-34158289 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1183462468 22:37960501-37960523 CTGGAGGCTGAGGCAGGAGAAGG - Intronic
1183557889 22:38545525-38545547 CGGGAGGCTGAGGCAGGAGATGG - Intronic
1183899109 22:40991684-40991706 TTGGAGGTGGAGGTCTGAGACGG - Intergenic
1184088977 22:42282677-42282699 CTGGGGGCAGAGACCTGGGAGGG + Intronic
1185011370 22:48316489-48316511 ATGGAGGCCAAAGTCTGAGAAGG + Intergenic
1185338566 22:50281690-50281712 CAGGAGGCCGAGGCCTTCGTGGG - Exonic
1203216764 22_KI270731v1_random:10683-10705 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1203273864 22_KI270734v1_random:74707-74729 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
949171968 3:1010803-1010825 CTGGAGGCTGAGGCAGGAGAAGG + Intergenic
950044640 3:9941682-9941704 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
950241551 3:11374796-11374818 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
950498763 3:13350796-13350818 CGGGAGGCTGAGGCAGGAGATGG - Intronic
952011944 3:28909711-28909733 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
953306329 3:41833399-41833421 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
953902326 3:46850285-46850307 CTTGAGGCTGAGGGATGAGAGGG - Intergenic
954084023 3:48229918-48229940 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
954150980 3:48656874-48656896 GTGGAGGCCGAGGCCAGGAAGGG + Exonic
954377366 3:50202203-50202225 CTGGGGGCCCAGGCCGGGGAAGG + Intergenic
954662455 3:52233293-52233315 GAGGAGGCCGAGGCCTCAGAGGG - Intronic
956779544 3:72593278-72593300 CAGGAGGCTGAGGCAAGAGAAGG + Intergenic
958430321 3:94032600-94032622 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
958538110 3:95430772-95430794 CGGGAGGCCGAGGCAGGAGAAGG + Intergenic
959492962 3:107013510-107013532 CGGGAGGCTGAGGCAGGAGATGG + Intergenic
959851321 3:111091358-111091380 CGGGAGGCTGAGGCAGGAGATGG - Intronic
959900171 3:111651774-111651796 CAGGAGGCTGAGGCAGGAGAAGG + Exonic
960640817 3:119820912-119820934 CGGGAGGCTGAGGCAGGAGATGG + Intergenic
960950554 3:122996128-122996150 CTGGAGGGCGAAGCCTAAGAGGG + Intronic
961148768 3:124618213-124618235 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
961339350 3:126207007-126207029 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
962773861 3:138640060-138640082 CGGGAGGCTGAGGCAGGAGATGG + Intergenic
962808205 3:138941489-138941511 CTGGAAGCCAAGGCTGGAGATGG - Intergenic
962826813 3:139106491-139106513 CTGGAGGTCTTGGCCTGAGAGGG - Intronic
963248546 3:143084418-143084440 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
963832317 3:150021500-150021522 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
964138432 3:153370250-153370272 GTGGATGCCGAGGCCTGAGGAGG + Intergenic
964315783 3:155442885-155442907 CGGGAGGCTGAGGCAAGAGATGG + Intronic
965346987 3:167563246-167563268 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
965744286 3:171907541-171907563 GTGGAGGCCGTGGCATGAGGAGG + Intronic
965947024 3:174255328-174255350 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
966356005 3:179079461-179079483 TTGGAGGCCGGGGCAGGAGAAGG + Intergenic
967839138 3:193990594-193990616 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
968015783 3:195331416-195331438 CGGGAGGCTGAGGCATGAGGTGG - Intronic
968653201 4:1767949-1767971 CTGGAAGCCGGGGCCTGGGGTGG - Intergenic
968737503 4:2304931-2304953 CTCGAGGCCGAGGGCACAGATGG - Exonic
969331755 4:6477618-6477640 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
969713449 4:8857551-8857573 GCGGAGGCCGAGGCCAGGGATGG - Intronic
971190249 4:24421414-24421436 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
971239519 4:24875222-24875244 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
971275071 4:25188526-25188548 CGGGAGGCTAAGGCCAGAGAAGG - Intronic
971574632 4:28257133-28257155 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
972567109 4:40279478-40279500 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
972811193 4:42587710-42587732 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
973857539 4:55028415-55028437 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
974031870 4:56783495-56783517 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
974299319 4:60042709-60042731 GTGGATGCCGTGGCCTGAGGAGG + Intergenic
975775318 4:77780040-77780062 GTTGATGCCGAGACCTGAGAGGG - Intronic
977085299 4:92588998-92589020 CGGGAGGCTGAGGCCGGAGAAGG + Intronic
977091056 4:92676283-92676305 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
977170210 4:93752474-93752496 CAGGAGGCTGAGGCAGGAGAAGG - Intronic
978187575 4:105875056-105875078 CGGGAGGCTGAGGCATGAGGTGG + Intronic
979219497 4:118205936-118205958 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
979687279 4:123524778-123524800 CAGGAGTCTGAGGCCTGTGATGG - Intergenic
979785550 4:124712337-124712359 CTGGGGCTCGAGGCCGGAGAGGG + Intronic
980793390 4:137649211-137649233 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
981123363 4:141077838-141077860 CTGGAGGCCTATGCCAGGGATGG + Intronic
981735778 4:147948858-147948880 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
982490946 4:156028854-156028876 CTGGAGGCTGAGGTGGGAGATGG + Intergenic
982606720 4:157525229-157525251 CGGGAGGCTGAGGCGGGAGAAGG - Intergenic
983651941 4:170044328-170044350 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
984911986 4:184682451-184682473 CCGGAGGCTGAGGCAGGAGATGG - Intronic
984984553 4:185315120-185315142 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
985574116 5:665741-665763 CTGGAGGGTGAGGCCTGGGGAGG - Intronic
985723551 5:1503340-1503362 GTGGAGGATGAGGCCTGGGAAGG - Intronic
985892965 5:2730447-2730469 CTGGCAGCAGAGGCCAGAGAGGG + Intergenic
986210260 5:5665172-5665194 AGGTAGGCAGAGGCCTGAGATGG + Intergenic
987319513 5:16755269-16755291 CTGGAGGCTGAGGCAGGAGAAGG - Intronic
987339716 5:16929056-16929078 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
987427737 5:17792642-17792664 CTGGAGGCTGAGGCAGGAGAAGG + Intergenic
989316812 5:40090699-40090721 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
991429691 5:66531292-66531314 ATGGAAGCAGAGGCCAGAGATGG - Intergenic
991902326 5:71473378-71473400 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
991965722 5:72088339-72088361 CGGGAGGCTGAGGCAGGAGATGG + Intergenic
992310221 5:75490602-75490624 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
992611601 5:78512858-78512880 CTGGATGCTGAGGCAGGAGAGGG - Intronic
994783185 5:104118748-104118770 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
994885888 5:105561298-105561320 CTGGAGGCTGAGGAAAGAGAAGG + Intergenic
995075420 5:107977940-107977962 CTGGAGACCCATGCCTAAGAAGG + Intronic
995493067 5:112712497-112712519 CAGGAGGCTAAGGGCTGAGATGG - Intronic
995828665 5:116329713-116329735 CTGGACGTCCAGGCCTGTGATGG + Intronic
996632534 5:125651883-125651905 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
997328779 5:133044142-133044164 CGGGAGGCTGAGGCAGGAGATGG - Intergenic
997377039 5:133404739-133404761 AAGGAGGCTGAGTCCTGAGATGG + Intronic
997760520 5:136444208-136444230 GTGGAGGGAGAGGCGTGAGAGGG + Intergenic
997928443 5:138052464-138052486 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
998815472 5:146009690-146009712 CAGGAGGCCAAGGCCTGGAAGGG - Intronic
999565326 5:152853603-152853625 CTGGGAGCTGTGGCCTGAGATGG + Intergenic
1000161066 5:158598286-158598308 CTGGAGGCTGAGGCAGGAGAAGG - Intergenic
1000530750 5:162416724-162416746 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
1001221133 5:169901977-169901999 CTGAAGGCCAATGCCTGATATGG - Intronic
1001738514 5:174028400-174028422 CTGGAGGCCAGGGCCTGGCATGG + Intergenic
1002270647 5:178069697-178069719 CGGGAGGCTGAGGCAGGAGATGG + Intergenic
1002319172 5:178364876-178364898 CTGGAGGCTGGGGCCTGGGCAGG - Intronic
1002581165 5:180209994-180210016 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1002688521 5:181034355-181034377 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1002822192 6:736197-736219 CGGGAGGCTGAGGCAGGAGAGGG + Intergenic
1003475013 6:6473477-6473499 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1003543536 6:7039227-7039249 CGGGAGGCTGAGGCGGGAGAAGG - Intergenic
1004163790 6:13237437-13237459 CAGGAGGCCCAGAACTGAGATGG - Intronic
1004858067 6:19771475-19771497 GTGGAGGCTGAGGCAGGAGAAGG + Intergenic
1004940593 6:20552095-20552117 TTGGAGGCCGAGGTGAGAGAGGG + Intronic
1005135916 6:22569894-22569916 CCGGAGCCCGAGGCCGCAGAGGG + Exonic
1005293747 6:24403336-24403358 CGGGAGGCCGAGGCCTGCGGAGG - Intronic
1005759155 6:28951753-28951775 CGGGAGGCTGAGGCTGGAGAAGG + Intergenic
1006476303 6:34256736-34256758 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
1006582153 6:35083361-35083383 CAGGAGGCTTAGCCCTGAGAAGG + Intronic
1007406749 6:41639833-41639855 GTGGAGGCTCAGGCCAGAGAAGG - Intronic
1008700342 6:54091745-54091767 CTGGAGGCCTAGGGTTTAGAAGG - Intronic
1009617768 6:66032471-66032493 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1009894221 6:69727047-69727069 CGGGAGGCTGAGGCAGGAGACGG + Intronic
1009973380 6:70648074-70648096 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1010078190 6:71826361-71826383 CAGGAGGCTGAGGCAAGAGAAGG + Intergenic
1011649804 6:89495126-89495148 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1013669055 6:112378311-112378333 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1013726320 6:113101454-113101476 CGGGAGGCTGAGGCAAGAGAAGG - Intergenic
1013874509 6:114806988-114807010 CTGGAGGCTGAAGGCTGAGGTGG + Intergenic
1014583025 6:123161839-123161861 CTGGAAGCCAGGGCCTGAAATGG + Intergenic
1015461073 6:133491844-133491866 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1015595350 6:134861118-134861140 CTGGAGTCCAAGGAATGAGAAGG + Intergenic
1015616223 6:135078180-135078202 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
1016420997 6:143883014-143883036 CTGAAGGTGGAGGCCTGAAATGG - Intronic
1017122955 6:151041172-151041194 CTGGAGGCGGTGGCCCTAGAGGG + Intronic
1017592184 6:155989761-155989783 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1017871093 6:158487170-158487192 CGGGAGGCTGAGGCAGGAGATGG + Intronic
1017925594 6:158909274-158909296 CAGGAGGCTGAGGCAGGAGAAGG + Intronic
1018278996 6:162164312-162164334 CAGGAGGCTGAGGCAGGAGATGG - Intronic
1018318913 6:162585805-162585827 CAGGAGGCTGAGGCAGGAGATGG - Intronic
1018895890 6:168016764-168016786 CTGGAGGCAGAGGCCAGTTAGGG + Intronic
1018931489 6:168242970-168242992 CTGGAAGCCGAGGCCTGCACAGG - Intergenic
1019536817 7:1533658-1533680 CTGGAGGCCGGAGCCTGGGCAGG + Intronic
1019832784 7:3349703-3349725 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1020037783 7:4975016-4975038 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1020150914 7:5681004-5681026 CTGGAGGCAGCAGCATGAGAGGG - Intronic
1020401530 7:7784439-7784461 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1020406307 7:7839453-7839475 TTGGTGGCCGAGGCAAGAGAAGG - Intronic
1020486018 7:8721670-8721692 CGGGAGGCTGAGGCAGGAGATGG + Intronic
1020527011 7:9275013-9275035 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1021949904 7:25764484-25764506 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1022101180 7:27169968-27169990 CGGGAGGCCGGGGCCAGACAGGG - Intronic
1022213193 7:28232325-28232347 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1022358706 7:29639677-29639699 CTGGAGGCGGTGGCCTGGGCTGG + Intergenic
1023480025 7:40624196-40624218 CTGGGGGAGGAGGCCTGAGGTGG - Intronic
1023743592 7:43302350-43302372 CGGGAAGCTGAAGCCTGAGAAGG - Intronic
1023965482 7:44961468-44961490 CTGGGGGCTGAGGGCTGAGGGGG + Intergenic
1024579778 7:50792800-50792822 CTGGGGGCCGCCGCCTGGGAGGG - Intronic
1025031646 7:55561600-55561622 CAGGAGGCCAAGGCAGGAGAGGG + Intronic
1025039360 7:55626945-55626967 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1025820019 7:64954403-64954425 CTGGAGGCTGAGGGAGGAGAAGG + Intergenic
1025978282 7:66386856-66386878 ATGGAAGCCGAGGTCAGAGAGGG - Intronic
1026060252 7:67019299-67019321 CAGGAGGCTGAGGCAGGAGATGG - Intronic
1026155340 7:67821154-67821176 CGGGAGGCAGAGGCAGGAGATGG - Intergenic
1026503020 7:70958981-70959003 CTGGAGGCCCAGGGCTGGCAAGG + Intergenic
1026523730 7:71137045-71137067 TGGGAGGCCAAGGCCTGAGGTGG - Intronic
1026599129 7:71759864-71759886 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1026900299 7:74033402-74033424 CTGGAGGCCGGAGCCAGGGAAGG + Intronic
1027227547 7:76253708-76253730 CGGGAGGCTGAGGCAGGAGACGG + Intronic
1027421145 7:78019463-78019485 CTGGAGGCCGAGGGCAGGGCGGG - Exonic
1029030163 7:97458673-97458695 CGGGAGGCTGAGGCAAGAGATGG + Intergenic
1029123028 7:98281293-98281315 GGGGAGGGCGGGGCCTGAGAGGG - Intronic
1029218420 7:98969291-98969313 CTGGAGGGAGAGGGATGAGATGG - Intronic
1029906418 7:104098067-104098089 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
1030234193 7:107241555-107241577 CCGGAGGCTGAGGCGGGAGAAGG - Intronic
1030358454 7:108569586-108569608 CTGGAGACCGGGGCCGGCGACGG + Exonic
1030906101 7:115184907-115184929 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1031472382 7:122182451-122182473 CTGGTGGCTGAGGCCTGGAAAGG - Intergenic
1031563579 7:123266979-123267001 CAGGAGGCTGAGGCAGGAGAAGG + Intergenic
1031568144 7:123324527-123324549 CGGGAGGCTGAGGCAGGAGATGG + Intergenic
1032014531 7:128369592-128369614 TGGGAGGCCGAGGCCGGAGCGGG + Intergenic
1032197545 7:129798317-129798339 CTGCAGGCAGAGGCTTGAGGAGG + Intergenic
1032240230 7:130154166-130154188 CTGGAAGCCCAGGTGTGAGAAGG - Intergenic
1032308557 7:130759870-130759892 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1032721587 7:134554607-134554629 CTGGAGGCGGTGGCCTGGGCTGG - Intronic
1032780080 7:135158405-135158427 CTGGAGCCTGAGACCAGAGAGGG + Intronic
1033009180 7:137601163-137601185 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1033310146 7:140255360-140255382 CTGGAATCCGAGCCCTGCGAGGG - Intergenic
1033417068 7:141171590-141171612 CGGGAGACCGAGGCCTGGCAAGG - Intronic
1033750875 7:144360214-144360236 CGGGAGGCTGAGGCAGGAGAGGG - Intronic
1034163039 7:149006468-149006490 CTGGAGGGCGATGTCTGTGAGGG - Intronic
1035158856 7:156936291-156936313 TGGGAGGCTGAGGCATGAGAAGG - Intergenic
1036015083 8:4774089-4774111 CAGGAGGCTGAGGCAGGAGAGGG + Intronic
1036249012 8:7145784-7145806 CCGGAGGCTGAGGCAGGAGACGG - Intergenic
1036487507 8:9192854-9192876 CCGGAGGCTGAGGCAGGAGAAGG + Intergenic
1036952588 8:13154689-13154711 GTGGACGCTGAGGCCTGAGGAGG + Intronic
1037944078 8:22975499-22975521 CTGGAGGCCTGAGGCTGAGAAGG + Intronic
1037980017 8:23246711-23246733 CGGGAGGCCGAGGCCCCAGCCGG + Exonic
1038021240 8:23553314-23553336 CAGGAGGCTGAGGCAGGAGATGG + Intronic
1038097939 8:24336472-24336494 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1039522242 8:38181044-38181066 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1039695588 8:39906960-39906982 GTGGAGGCTGAGGGCTGAGATGG + Intronic
1039994579 8:42520618-42520640 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1040088540 8:43370914-43370936 CGGGAGGCCAAGGCAGGAGAAGG - Intergenic
1041136931 8:54768999-54769021 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1041588245 8:59546506-59546528 CAGGAGGCCGAGGCAGTAGAAGG + Intergenic
1041893829 8:62901512-62901534 CTGTAGGCCCAGCTCTGAGAAGG - Intronic
1042178077 8:66057031-66057053 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1043582159 8:81726829-81726851 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1044229401 8:89757594-89757616 GCGGAGGCCGAGGGCTGGGACGG - Intergenic
1044873740 8:96644930-96644952 CGGGCGGCAGGGGCCTGAGAAGG - Intergenic
1044989746 8:97785189-97785211 CGGGAGGCTGAGGCAAGAGAAGG - Intronic
1045629688 8:104103969-104103991 CTGAAGGTAGAGGACTGAGAAGG + Intronic
1045808672 8:106195871-106195893 ATGGAGGCCAAAGGCTGAGAAGG + Intergenic
1048248048 8:132830948-132830970 CTGGAGGCCGAGAGCTAAGACGG - Intronic
1049089956 8:140507208-140507230 CTGGAGGCGCATGACTGAGAAGG + Intergenic
1049263461 8:141652419-141652441 CTGGATGCTGAGGGCTGAGGTGG - Intergenic
1049358850 8:142202313-142202335 CTGGAGGCCTGGGCATGGGAGGG - Intergenic
1049369905 8:142259380-142259402 CTGGGGTCCCAGGCCTGAGAGGG + Intronic
1049536033 8:143182971-143182993 CTGGAGAGGGAGGGCTGAGAAGG - Intergenic
1049717824 8:144101512-144101534 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1049798696 8:144507972-144507994 CTGGCTGCCGAGGCCTCTGAGGG - Intergenic
1049808310 8:144551450-144551472 ATGCAGGCCGAGGCCTGTGCTGG + Intronic
1049909028 9:247637-247659 CGGGAGGCTGAGGCCGGAGAAGG - Intronic
1049972272 9:831721-831743 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1050642182 9:7680071-7680093 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1050685318 9:8162235-8162257 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1050845243 9:10208406-10208428 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1051266231 9:15311594-15311616 CTGGAGGCTAAGGCATGAGGAGG + Intergenic
1051423788 9:16914660-16914682 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1053326906 9:37161467-37161489 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1053684337 9:40507306-40507328 CTGGAGGCAGTGGCCCTAGAGGG + Intergenic
1053874050 9:42524879-42524901 TGGGAGGCCGAGGCAGGAGATGG - Intergenic
1053934306 9:43135592-43135614 CTGGAGGCGGTGGCCCTAGAGGG + Intergenic
1054268284 9:62941877-62941899 TGGGAGGCCGAGGCAGGAGATGG + Intergenic
1054279388 9:63117647-63117669 CTGGAGGCAGTGGCCCTAGAGGG - Intergenic
1054297431 9:63342770-63342792 CTGGAGGCAGTGGCCCTAGAGGG + Intergenic
1054395449 9:64647278-64647300 CTGGAGGCAGTGGCCCTAGAGGG + Intergenic
1054500288 9:65869054-65869076 CTGGAGGCAGTGGCCCTAGAGGG - Intergenic
1054749070 9:68886071-68886093 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1055482506 9:76723911-76723933 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1055529283 9:77167877-77167899 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1056849483 9:90070326-90070348 CTGGAGGCTGAGCTCTGAAAAGG + Intergenic
1057141021 9:92726890-92726912 CTGGTGGCAGAGGCCAAAGAGGG - Intronic
1057146909 9:92764743-92764765 ATGGTGGCCGAGGGCTGAGCCGG + Exonic
1059099754 9:111458841-111458863 ATGTAGGGCAAGGCCTGAGAGGG - Intronic
1059345549 9:113625557-113625579 GTGGAGGCTCAGGCCTGGGATGG + Intergenic
1059443634 9:114324929-114324951 ATGGGGGGTGAGGCCTGAGAGGG - Intronic
1059444834 9:114331706-114331728 ATGGGGGGTGAGGCCTGAGAGGG - Intronic
1060072154 9:120559379-120559401 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1060107323 9:120881251-120881273 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1060114733 9:120930825-120930847 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1060121355 9:120993526-120993548 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1060557492 9:124516167-124516189 CTGGAGGCTGAGGAATGGGAAGG + Intergenic
1060811967 9:126615187-126615209 CCGGAGCCCGAGGACTGGGACGG + Intronic
1060940046 9:127537980-127538002 GTGGAGACAGAGGCCTGGGATGG - Intronic
1060967779 9:127721264-127721286 CTGGAGGCCAGAGCCTGAGAAGG + Intronic
1060988592 9:127835608-127835630 CTGGTGGCCAAGCCCTGAGTGGG + Intronic
1060995483 9:127873124-127873146 CTGGAGTCCCAGGCCTGTGCTGG + Intronic
1061481608 9:130900174-130900196 CTGGAGGCAGAGACCAGAGCTGG + Intergenic
1061556219 9:131371206-131371228 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1061576027 9:131506959-131506981 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1062364796 9:136203426-136203448 CCAGAGGCAGAGGCCTGAGCTGG + Intronic
1062400959 9:136372439-136372461 CAGGAGGCAGAGGCCAGAGGGGG - Intronic
1062439814 9:136564622-136564644 CTGGGGGCCGAGGCCCAAAATGG + Intergenic
1062446695 9:136598240-136598262 CTGGGGGCCCAGGGCAGAGACGG + Intergenic
1062542590 9:137048253-137048275 CTGGAGACCCAGCCCTGAGGAGG + Exonic
1062659688 9:137623105-137623127 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1062694239 9:137865008-137865030 CTGGAGTCTGTGGCCTGTGAGGG + Intronic
1062706417 9:137946502-137946524 CTGAAGGCCGAGGAATGATAGGG - Intronic
1185617749 X:1433572-1433594 CGGGAGGCTGAGGCAGGAGAAGG + Intronic
1186371255 X:8949673-8949695 CTGCAGCCCCAGGCCAGAGACGG + Intergenic
1186813714 X:13215138-13215160 CTGGAGGAGGAGGCCTCAGGAGG + Intergenic
1187504719 X:19869575-19869597 CAGGAGGCAGTAGCCTGAGAAGG + Intronic
1189337010 X:40176340-40176362 CGTGAGGCCGAGGCCGGGGAGGG - Intronic
1190102007 X:47529007-47529029 CGGGAGGCTGAGGGCTGAGGTGG + Intergenic
1193285744 X:79712972-79712994 CGGGAGGCTGAGGCAGGAGAAGG + Intergenic
1194298410 X:92155730-92155752 CCGGAGGCTGAGGCAGGAGAAGG - Intronic
1195062754 X:101212479-101212501 GTGGCTGCCTAGGCCTGAGAAGG + Intergenic
1196278750 X:113798366-113798388 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1196629951 X:117927009-117927031 CGGGAGGCTGAGGCAGGAGAAGG - Intronic
1196820373 X:119695734-119695756 CTGGAGGCCCAGGCCCCAGGAGG - Intergenic
1196895929 X:120335669-120335691 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1197206075 X:123791890-123791912 CGGGAGGCTGAGGCAGGAGAAGG - Intergenic
1198835612 X:140801982-140802004 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1199017622 X:142837284-142837306 CAGGAGGCTGAGGCAGGAGAAGG - Intergenic
1199983346 X:152933227-152933249 CTGGAGGCCCAGCCCTCACATGG + Intronic
1201226854 Y:11826870-11826892 CGGGAGGCTGAGGCAGGAGATGG + Intergenic
1201282728 Y:12355278-12355300 CCGGAGGCAGTGCCCTGAGATGG + Intergenic