ID: 1122770125

View in Genome Browser
Species Human (GRCh38)
Location 14:104094097-104094119
Sequence GGTCCACGTGTCAGAGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122770113_1122770125 28 Left 1122770113 14:104094046-104094068 CCAGCCTGGGGCCTGGGAGCATC 0: 1
1: 0
2: 4
3: 67
4: 481
Right 1122770125 14:104094097-104094119 GGTCCACGTGTCAGAGCTGCGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1122770115_1122770125 24 Left 1122770115 14:104094050-104094072 CCTGGGGCCTGGGAGCATCTGGG 0: 1
1: 0
2: 5
3: 51
4: 511
Right 1122770125 14:104094097-104094119 GGTCCACGTGTCAGAGCTGCGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1122770118_1122770125 17 Left 1122770118 14:104094057-104094079 CCTGGGAGCATCTGGGAATGGCA 0: 1
1: 0
2: 0
3: 12
4: 271
Right 1122770125 14:104094097-104094119 GGTCCACGTGTCAGAGCTGCGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1122770112_1122770125 29 Left 1122770112 14:104094045-104094067 CCCAGCCTGGGGCCTGGGAGCAT 0: 1
1: 0
2: 5
3: 32
4: 408
Right 1122770125 14:104094097-104094119 GGTCCACGTGTCAGAGCTGCGGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122770125 Original CRISPR GGTCCACGTGTCAGAGCTGC GGG Intronic