ID: 1122773688

View in Genome Browser
Species Human (GRCh38)
Location 14:104108002-104108024
Sequence CCCTCCCCGAAAAGAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122773688_1122773693 5 Left 1122773688 14:104108002-104108024 CCCTGGGTTCTTTTCGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1122773693 14:104108030-104108052 TCAGGAGTCCCATGGAGAGAAGG 0: 1
1: 0
2: 6
3: 25
4: 277
1122773688_1122773692 -3 Left 1122773688 14:104108002-104108024 CCCTGGGTTCTTTTCGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1122773692 14:104108022-104108044 GGGAGTGCTCAGGAGTCCCATGG 0: 1
1: 0
2: 4
3: 16
4: 268
1122773688_1122773699 24 Left 1122773688 14:104108002-104108024 CCCTGGGTTCTTTTCGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1122773699 14:104108049-104108071 AAGGCCGGGGTGTCTGAGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 185
1122773688_1122773696 11 Left 1122773688 14:104108002-104108024 CCCTGGGTTCTTTTCGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1122773696 14:104108036-104108058 GTCCCATGGAGAGAAGGCCGGGG 0: 1
1: 0
2: 1
3: 20
4: 153
1122773688_1122773701 26 Left 1122773688 14:104108002-104108024 CCCTGGGTTCTTTTCGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1122773701 14:104108051-104108073 GGCCGGGGTGTCTGAGCCTGGGG 0: 1
1: 0
2: 3
3: 30
4: 290
1122773688_1122773695 10 Left 1122773688 14:104108002-104108024 CCCTGGGTTCTTTTCGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1122773695 14:104108035-104108057 AGTCCCATGGAGAGAAGGCCGGG 0: 1
1: 0
2: 2
3: 27
4: 232
1122773688_1122773700 25 Left 1122773688 14:104108002-104108024 CCCTGGGTTCTTTTCGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1122773700 14:104108050-104108072 AGGCCGGGGTGTCTGAGCCTGGG 0: 1
1: 0
2: 2
3: 21
4: 262
1122773688_1122773694 9 Left 1122773688 14:104108002-104108024 CCCTGGGTTCTTTTCGGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1122773694 14:104108034-104108056 GAGTCCCATGGAGAGAAGGCCGG 0: 1
1: 0
2: 1
3: 32
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122773688 Original CRISPR CCCTCCCCGAAAAGAACCCA GGG (reversed) Intronic
901059574 1:6465825-6465847 CCCTCCCCCAACAGAAAGCATGG - Intronic
902360346 1:15939038-15939060 CCCATCCTGAAGAGAACCCAGGG + Intronic
902549997 1:17213724-17213746 CCCTGCCCCACTAGAACCCATGG + Intronic
903833711 1:26189630-26189652 CCCACCCTGAACAGAATCCAGGG - Exonic
912777213 1:112513371-112513393 CCCTCCCCTAACAAATCCCATGG - Intronic
915167987 1:153959202-153959224 CCCTCCCCAAAAATAACGCTGGG + Exonic
916010923 1:160704911-160704933 CCCTCCACAAAAAGGACCAATGG - Intronic
916996467 1:170307086-170307108 CCCCCCCCAAAAAAAACACACGG + Intergenic
917479931 1:175403296-175403318 CCTTCCCCGAACAGTCCCCAGGG + Exonic
920648311 1:207819014-207819036 CCCTCCCTGAAAATGACCCCAGG + Intergenic
921354309 1:214271780-214271802 CCCACCCCAAAAAGTACCAAAGG - Intergenic
922338805 1:224639126-224639148 CCCTCCCAGCAAGGACCCCAGGG + Intronic
1063090476 10:2861965-2861987 CCCTCTCAACAAAGAACCCATGG + Intergenic
1063132864 10:3193658-3193680 GCCTCCCCGAAATGAAGCCGTGG + Intergenic
1067376672 10:45733613-45733635 CTCACCCTGAAAAGATCCCATGG + Intronic
1067884366 10:50074304-50074326 CTCACCCTGAAAAGATCCCATGG + Intronic
1071093218 10:81944795-81944817 CCCTTCCAGTAAAGCACCCATGG + Intronic
1073631629 10:105155395-105155417 CCCTCTCCCACAAGTACCCAGGG - Intronic
1076948567 10:133666913-133666935 CCCACCCCGGAAGGGACCCAGGG - Intergenic
1076949551 10:133670212-133670234 CCCACCCCGGAAGGGACCCAGGG - Intronic
1076950535 10:133673511-133673533 CCCACCCCGGAAGGGACCCAGGG - Intergenic
1076951525 10:133676821-133676843 CCCACCCCGGAAGGGACCCAGGG - Intergenic
1076952515 10:133680131-133680153 CCCACCCCGGAAGGGACCCAGGG - Intergenic
1076953498 10:133683430-133683452 CCCACCCCGGAAGGGACCCAGGG - Intergenic
1076955471 10:133743092-133743114 CCCACCCCGGAAGGGACCCAGGG - Intergenic
1076956461 10:133746402-133746424 CCCACCCCGGAAGGGACCCAGGG - Intergenic
1076957449 10:133749711-133749733 CCCACCCCGGAAGGGACCCAGGG - Intergenic
1076958433 10:133753010-133753032 CCCACCCCGGAAGGGACCCAGGG - Intergenic
1076959422 10:133756320-133756342 CCCACCCCGGAAGGGACCCAGGG - Intergenic
1076960406 10:133759619-133759641 CCCACCCCGGAAGGGACCCAGGG - Intergenic
1077917579 11:6621519-6621541 CCCTCACTGAGGAGAACCCAGGG + Exonic
1078581412 11:12542284-12542306 CCCTCCCCTAAGAGAACCTCAGG + Intergenic
1079828716 11:25233866-25233888 TCCTCCCAGGAAAGAGCCCAGGG - Intergenic
1080611433 11:33907397-33907419 CTTTCCCCGGAAAGACCCCACGG + Intergenic
1081860396 11:46330229-46330251 CACTCCCTGGAAAGACCCCAGGG - Intergenic
1085718193 11:78891136-78891158 ACCTCCCCCAGAAGATCCCAGGG + Intronic
1097118766 12:56717556-56717578 CCCTCCCCAAAAGGAAGCCCAGG - Intronic
1097827887 12:64193184-64193206 CATTACCCCAAAAGAACCCATGG + Exonic
1097990352 12:65825943-65825965 CCCTCCCGACAAAGAACGCATGG + Intronic
1101346866 12:103894135-103894157 CCCTGCCCTAAATCAACCCAGGG + Intergenic
1101529694 12:105562794-105562816 ACCTCCCTCAAAAGAACACAGGG - Intergenic
1103252403 12:119511584-119511606 CCCTCCCCAAAAAGAAGAAATGG + Intronic
1107830620 13:44371855-44371877 CCCTCCCCAAAAAGTTCCCACGG - Intergenic
1113569014 13:111339939-111339961 CCCTCCCAGTAAAGAACAAAGGG - Intronic
1113615838 13:111680220-111680242 CCTTCCCTGAAAAGGACACAGGG + Intergenic
1113621306 13:111765113-111765135 CCTTCCCTGAAAAGGACACAGGG + Intergenic
1113766002 13:112881532-112881554 CCATCCCAGGGAAGAACCCAGGG - Intronic
1113942805 13:114027189-114027211 TCCTCTCCGGAAGGAACCCAGGG + Intronic
1113942820 13:114027230-114027252 TCCTCTCCGGAAGGAACCCAGGG + Intronic
1114675679 14:24438802-24438824 CCCACACAGAACAGAACCCAGGG - Exonic
1119434610 14:74589779-74589801 CCCTCCCTAAAAAAACCCCAAGG - Intronic
1122017358 14:98807636-98807658 CCTTCCCACAAAAGATCCCATGG + Intergenic
1122773688 14:104108002-104108024 CCCTCCCCGAAAAGAACCCAGGG - Intronic
1127730890 15:61801048-61801070 CCCTCCCAGATCAGACCCCATGG + Intergenic
1130893101 15:88150042-88150064 GCCTCCCTGAACAAAACCCATGG + Intronic
1130935561 15:88467631-88467653 CCCTCCCCGACAGGCACTCATGG + Exonic
1131237673 15:90711048-90711070 CCCTGCCCTAAATTAACCCAAGG + Intergenic
1132759364 16:1501351-1501373 CCCTCCCCGAGACGGAGCCACGG - Intronic
1133914715 16:10098935-10098957 CCCCCCCCAAAAAAAACCTATGG + Intronic
1138101244 16:54253834-54253856 CCCTCCCCCAAAAGCATCCTGGG + Intronic
1138662912 16:58535651-58535673 TTCTCCCCTAAAAGAATCCAGGG - Intronic
1141359675 16:83383820-83383842 CCCTCCATGAAAAGAAACCAAGG - Intronic
1142738851 17:1918567-1918589 CCCTTCCCGCTAAGAACACAGGG - Intergenic
1143231322 17:5357984-5358006 CCCTGCCCTAAATGAACCCAGGG - Intronic
1145939466 17:28735075-28735097 CCCTCCCCCTAAAAAACCCTTGG + Intronic
1146200394 17:30852399-30852421 TCCTCCACGAAAAGGAACCAGGG - Intronic
1147169227 17:38608503-38608525 AGCTCCCTGAATAGAACCCAAGG + Intergenic
1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG + Intergenic
1150287572 17:63962641-63962663 CCCTCCCCGGCATGAATCCAGGG - Intronic
1152111847 17:78360958-78360980 CCCTCCCCTAGGAGACCCCAGGG - Intergenic
1152146144 17:78570056-78570078 CCCTCCCCTAGAAGAACTCTAGG + Intronic
1154026610 18:10713682-10713704 CTCTCCCAGAATAGAGCCCAGGG + Intronic
1154192773 18:12244125-12244147 CCCTCTCCGAGAAACACCCAAGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1160735882 19:662339-662361 CCCTCACCGAAGAGGACCCTGGG - Intronic
1161702232 19:5801975-5801997 CTATCCCAGAAAGGAACCCAGGG - Intergenic
1162084481 19:8240307-8240329 CACTCCCCCCAAAGACCCCAAGG - Intronic
1166742832 19:45124582-45124604 CCCTGCCAGACAAGAACCCCTGG + Intronic
1167049434 19:47069360-47069382 CCCTTCCCGACATGAACCCTCGG - Intronic
1168540153 19:57203229-57203251 CCCTGCCCTAAATCAACCCAGGG - Intronic
925303365 2:2832675-2832697 CCCACCCCTGGAAGAACCCACGG + Intergenic
934522764 2:95030346-95030368 CCCTCCTCCAACAAAACCCAGGG + Intronic
937120798 2:119438944-119438966 CCCTCCCCGTGAAGAAACCAGGG - Intergenic
937578203 2:123450910-123450932 CCCTCCCCCACAATAACCCAGGG + Intergenic
937583641 2:123519890-123519912 CACTCCCCCAAAAAAACCAAAGG - Intergenic
941828435 2:169926097-169926119 CCCTCCCCTAAATCAACCCAGGG - Intronic
941870026 2:170374260-170374282 CCCTACCCACAAAGATCCCAAGG - Intronic
942194817 2:173507028-173507050 CCCTCCCTGCCAATAACCCAGGG - Intergenic
942956592 2:181781172-181781194 CCCTGCCTGGCAAGAACCCAGGG - Intergenic
942987653 2:182161973-182161995 CCCTCCTCTAAATGAAACCAAGG - Intronic
944370369 2:198974983-198975005 CTCTTCTCTAAAAGAACCCAGGG + Intergenic
1170803041 20:19606151-19606173 CTCTCCCTGAAAATTACCCAGGG + Intronic
1171360918 20:24585840-24585862 CCCTCCCTGAGAACACCCCATGG - Intronic
1172091141 20:32433799-32433821 CCTTTCCCGAAAAGAAGCCCCGG + Exonic
1173553182 20:43947644-43947666 CTCTCCCAGTCAAGAACCCATGG - Intronic
1173822140 20:46026344-46026366 CCCTCCCCACCAAGAACCCTGGG - Intronic
1174680230 20:52399438-52399460 CACTCCCCGAAAAAATCCAAGGG - Intergenic
1181376150 22:22459800-22459822 CCCTCCCCTAAGAGACACCAGGG + Intergenic
1182454916 22:30444094-30444116 CCCTCCCCGAAAATAACCTTTGG - Intergenic
949686025 3:6571700-6571722 CCCTCCCCCACAAAAACTCATGG - Intergenic
954770638 3:52964980-52965002 CTCTCCCATAAAAGAACCAAAGG + Intronic
955777237 3:62446981-62447003 GTCTCCCAGAAAAGTACCCAGGG + Intronic
955946547 3:64200082-64200104 CCCTCCCCAAAAGAAACCCCAGG + Intronic
956819617 3:72941950-72941972 CCATCCTCCAAAGGAACCCAGGG + Intronic
958852941 3:99350608-99350630 CCATCCCCAAGAAAAACCCAGGG - Intergenic
960617876 3:119612897-119612919 CCCTCCCAGAAAAGACCCAAGGG - Intronic
963406970 3:144878005-144878027 CCCCCCCCCAAAAAAACCAAAGG + Intergenic
968081515 3:195849705-195849727 ACCTCCCCTAATAGAACCCTGGG + Intergenic
969093251 4:4712677-4712699 CCCTGCCCTAAATCAACCCAGGG - Intergenic
972323886 4:37996912-37996934 CCCTCACAGACAAAAACCCATGG - Intronic
975182733 4:71365520-71365542 CCCTCCTTTAAATGAACCCATGG - Intronic
977176167 4:93822408-93822430 CCCTCCCAGAGAAGGACACATGG + Intergenic
979347018 4:119600470-119600492 CCCCCCACTAAAAGAAACCAGGG + Intronic
982805543 4:159758395-159758417 CTCTCCCCAAAAATAAACCATGG - Intergenic
983882621 4:172950486-172950508 CCGTCCACCAAAAGCACCCAAGG + Intronic
985452020 4:190067697-190067719 CCCACCCCGGAAGGGACCCAGGG - Intergenic
985453005 4:190070994-190071016 CCCACCCCGGAAGGGACCCAGGG - Intergenic
985453994 4:190074287-190074309 CCCACCCCGGAAGGGACCCAGGG - Intergenic
985454982 4:190077580-190077602 CCCACCCCGGAAGGGACCCAGGG - Intergenic
985455971 4:190080880-190080902 CCCACCCCGGAAGGGACCCAGGG - Intergenic
985456954 4:190084174-190084196 CCCACCCCGGAAGGGACCCAGGG - Intergenic
985457941 4:190087467-190087489 CCCACCCCGGAAGGGACCCAGGG - Intergenic
985458930 4:190090767-190090789 CCCACCCCGGAAGGGACCCAGGG - Intergenic
985463182 4:190173532-190173554 CCCACCCCGGAAGGGACCCAGGG - Intergenic
992423287 5:76628156-76628178 CCCTCCCCCAAAGGGACCTATGG + Intronic
995191330 5:109321934-109321956 CCTTCCACTAAAAGAAACCAGGG - Intergenic
995653871 5:114402684-114402706 CCCTCGAGGAAAACAACCCATGG + Intronic
997030041 5:130116970-130116992 CTCTCCCCCAAAAGAAGCCCAGG - Intronic
997558072 5:134818949-134818971 CCCTCCTGGCAAAGAACCCAAGG + Exonic
997575790 5:134976350-134976372 CCCACCCCCAAAAAAACCCAAGG + Intronic
997932580 5:138084373-138084395 CCCTCACCCAGAGGAACCCATGG + Intronic
998096708 5:139399921-139399943 CCCTACCAGGAAAGAACCCCAGG + Intronic
999499976 5:152137112-152137134 CCCTCCTCCAAAACAGCCCAGGG - Intergenic
1003339296 6:5204315-5204337 CCTTTCCAGAAAAGAAGCCAAGG - Intronic
1005267088 6:24123475-24123497 CCCTTCTGGAAAACAACCCAGGG + Intergenic
1012359612 6:98360887-98360909 CCCTCCTCAAAAAAAATCCAGGG - Intergenic
1014256097 6:119161220-119161242 CCTTCCCACCAAAGAACCCATGG + Intergenic
1017636098 6:156444523-156444545 CCCTCCTCCACAAGAACCCTTGG + Intergenic
1019798190 7:3067592-3067614 ACCCCCCCAAAAAAAACCCATGG - Intergenic
1021444715 7:20720046-20720068 TTCTCCACTAAAAGAACCCAGGG + Intronic
1021860408 7:24900520-24900542 CTTTCCCAGAAAAGAACTCAGGG - Intronic
1023933998 7:44726142-44726164 CCCTGCCCGAAATCAACACAGGG + Intergenic
1032279636 7:130490706-130490728 CCCGGCCCGAAAACAACACACGG - Intronic
1037710998 8:21355405-21355427 CCCTCCCCAAACAGTAGCCAAGG - Intergenic
1038051023 8:23811637-23811659 CCCTGCCCTAAATCAACCCAGGG - Intergenic
1038056619 8:23864355-23864377 CCCTCCAAGAAAACAAGCCATGG - Intergenic
1045513160 8:102831050-102831072 CTCTCCACGAAAACAAACCAAGG + Intronic
1045908427 8:107376354-107376376 CTCTCCTGGAAAAGAACTCAGGG - Intronic
1048091255 8:131242804-131242826 CCCTCCCTGAAAATATTCCAGGG - Intergenic
1048390959 8:133963986-133964008 GCCTCCCTGAGAAGAAGCCATGG - Intergenic
1050604809 9:7289741-7289763 CCCTTCCCCAAATGTACCCACGG + Intergenic
1056158070 9:83859500-83859522 CCCTCCCTCAAAAAAATCCATGG - Intronic
1056352480 9:85764557-85764579 CCCTCCCTCAAAAAAATCCATGG + Intergenic
1059979604 9:119756602-119756624 CCCCCCCCAAAAAAAACCCTCGG + Intergenic
1061428720 9:130517784-130517806 CCCTGCCCGAAATCAATCCAGGG + Intergenic
1061732120 9:132623669-132623691 GCCTCTCCGAAAAGAAACTAAGG + Intronic
1061880640 9:133567175-133567197 CCCTCCTCGAAGAGCCCCCACGG - Intronic
1062479360 9:136744293-136744315 CCTTCCCCCAAGAGAGCCCAGGG + Intronic
1186480219 X:9890959-9890981 TCCTCCTAGAAAAGAACGCAGGG - Exonic
1189722504 X:43934546-43934568 CCCTCCCCTAAAACACCCCAGGG + Intergenic
1191936386 X:66431797-66431819 CCCTCCCTGAAAAGAAAGAAGGG - Intergenic
1195335058 X:103844717-103844739 CCCTACCCCAAAAGAAGCCCAGG + Intergenic
1195737157 X:108023937-108023959 CCCTGCCCTAAATCAACCCAGGG - Intergenic
1196262164 X:113596076-113596098 CCCTCCCCACACTGAACCCATGG + Intergenic
1201304350 Y:12537755-12537777 CACTCCTGGAAAAGAACGCAGGG - Intergenic