ID: 1122775607

View in Genome Browser
Species Human (GRCh38)
Location 14:104115828-104115850
Sequence TGGGGATGGAAGTGGGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122775607_1122775615 -1 Left 1122775607 14:104115828-104115850 CCCTATGCCCACTTCCATCCCCA No data
Right 1122775615 14:104115850-104115872 ACCCCCATGCCGCAGCCCCTCGG No data
1122775607_1122775621 13 Left 1122775607 14:104115828-104115850 CCCTATGCCCACTTCCATCCCCA No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122775607 Original CRISPR TGGGGATGGAAGTGGGCATA GGG (reversed) Intergenic
No off target data available for this crispr