ID: 1122775609

View in Genome Browser
Species Human (GRCh38)
Location 14:104115835-104115857
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122775609_1122775615 -8 Left 1122775609 14:104115835-104115857 CCCACTTCCATCCCCACCCCCAT No data
Right 1122775615 14:104115850-104115872 ACCCCCATGCCGCAGCCCCTCGG No data
1122775609_1122775621 6 Left 1122775609 14:104115835-104115857 CCCACTTCCATCCCCACCCCCAT No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122775609 Original CRISPR ATGGGGGTGGGGATGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr