ID: 1122775611

View in Genome Browser
Species Human (GRCh38)
Location 14:104115842-104115864
Sequence CTGCGGCATGGGGGTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122775611_1122775621 -1 Left 1122775611 14:104115842-104115864 CCATCCCCACCCCCATGCCGCAG No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data
1122775611_1122775628 26 Left 1122775611 14:104115842-104115864 CCATCCCCACCCCCATGCCGCAG No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122775611 Original CRISPR CTGCGGCATGGGGGTGGGGA TGG (reversed) Intergenic
No off target data available for this crispr