ID: 1122775612

View in Genome Browser
Species Human (GRCh38)
Location 14:104115846-104115868
Sequence GGGGCTGCGGCATGGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122775612_1122775631 27 Left 1122775612 14:104115846-104115868 CCCCACCCCCATGCCGCAGCCCC No data
Right 1122775631 14:104115896-104115918 CCACAGATGCAGCGATGGCAAGG No data
1122775612_1122775621 -5 Left 1122775612 14:104115846-104115868 CCCCACCCCCATGCCGCAGCCCC No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data
1122775612_1122775628 22 Left 1122775612 14:104115846-104115868 CCCCACCCCCATGCCGCAGCCCC No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122775612 Original CRISPR GGGGCTGCGGCATGGGGGTG GGG (reversed) Intergenic
No off target data available for this crispr