ID: 1122775614

View in Genome Browser
Species Human (GRCh38)
Location 14:104115848-104115870
Sequence GAGGGGCTGCGGCATGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122775614_1122775628 20 Left 1122775614 14:104115848-104115870 CCACCCCCATGCCGCAGCCCCTC No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data
1122775614_1122775631 25 Left 1122775614 14:104115848-104115870 CCACCCCCATGCCGCAGCCCCTC No data
Right 1122775631 14:104115896-104115918 CCACAGATGCAGCGATGGCAAGG No data
1122775614_1122775621 -7 Left 1122775614 14:104115848-104115870 CCACCCCCATGCCGCAGCCCCTC No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122775614 Original CRISPR GAGGGGCTGCGGCATGGGGG TGG (reversed) Intergenic
No off target data available for this crispr