ID: 1122775615

View in Genome Browser
Species Human (GRCh38)
Location 14:104115850-104115872
Sequence ACCCCCATGCCGCAGCCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122775609_1122775615 -8 Left 1122775609 14:104115835-104115857 CCCACTTCCATCCCCACCCCCAT No data
Right 1122775615 14:104115850-104115872 ACCCCCATGCCGCAGCCCCTCGG No data
1122775610_1122775615 -9 Left 1122775610 14:104115836-104115858 CCACTTCCATCCCCACCCCCATG No data
Right 1122775615 14:104115850-104115872 ACCCCCATGCCGCAGCCCCTCGG No data
1122775608_1122775615 -2 Left 1122775608 14:104115829-104115851 CCTATGCCCACTTCCATCCCCAC No data
Right 1122775615 14:104115850-104115872 ACCCCCATGCCGCAGCCCCTCGG No data
1122775607_1122775615 -1 Left 1122775607 14:104115828-104115850 CCCTATGCCCACTTCCATCCCCA No data
Right 1122775615 14:104115850-104115872 ACCCCCATGCCGCAGCCCCTCGG No data
1122775606_1122775615 0 Left 1122775606 14:104115827-104115849 CCCCTATGCCCACTTCCATCCCC No data
Right 1122775615 14:104115850-104115872 ACCCCCATGCCGCAGCCCCTCGG No data
1122775604_1122775615 27 Left 1122775604 14:104115800-104115822 CCAAGCTCCTGTTCTTGATCTCA No data
Right 1122775615 14:104115850-104115872 ACCCCCATGCCGCAGCCCCTCGG No data
1122775605_1122775615 20 Left 1122775605 14:104115807-104115829 CCTGTTCTTGATCTCAAGCTCCC No data
Right 1122775615 14:104115850-104115872 ACCCCCATGCCGCAGCCCCTCGG No data
1122775603_1122775615 28 Left 1122775603 14:104115799-104115821 CCCAAGCTCCTGTTCTTGATCTC No data
Right 1122775615 14:104115850-104115872 ACCCCCATGCCGCAGCCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122775615 Original CRISPR ACCCCCATGCCGCAGCCCCT CGG Intergenic
No off target data available for this crispr