ID: 1122775616

View in Genome Browser
Species Human (GRCh38)
Location 14:104115851-104115873
Sequence TCCGAGGGGCTGCGGCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122775616_1122775621 -10 Left 1122775616 14:104115851-104115873 CCCCCATGCCGCAGCCCCTCGGA No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data
1122775616_1122775628 17 Left 1122775616 14:104115851-104115873 CCCCCATGCCGCAGCCCCTCGGA No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data
1122775616_1122775631 22 Left 1122775616 14:104115851-104115873 CCCCCATGCCGCAGCCCCTCGGA No data
Right 1122775631 14:104115896-104115918 CCACAGATGCAGCGATGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122775616 Original CRISPR TCCGAGGGGCTGCGGCATGG GGG (reversed) Intergenic
No off target data available for this crispr