ID: 1122775621

View in Genome Browser
Species Human (GRCh38)
Location 14:104115864-104115886
Sequence GCCCCTCGGACTCCACACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122775607_1122775621 13 Left 1122775607 14:104115828-104115850 CCCTATGCCCACTTCCATCCCCA No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data
1122775609_1122775621 6 Left 1122775609 14:104115835-104115857 CCCACTTCCATCCCCACCCCCAT No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data
1122775608_1122775621 12 Left 1122775608 14:104115829-104115851 CCTATGCCCACTTCCATCCCCAC No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data
1122775606_1122775621 14 Left 1122775606 14:104115827-104115849 CCCCTATGCCCACTTCCATCCCC No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data
1122775614_1122775621 -7 Left 1122775614 14:104115848-104115870 CCACCCCCATGCCGCAGCCCCTC No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data
1122775611_1122775621 -1 Left 1122775611 14:104115842-104115864 CCATCCCCACCCCCATGCCGCAG No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data
1122775616_1122775621 -10 Left 1122775616 14:104115851-104115873 CCCCCATGCCGCAGCCCCTCGGA No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data
1122775610_1122775621 5 Left 1122775610 14:104115836-104115858 CCACTTCCATCCCCACCCCCATG No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data
1122775613_1122775621 -6 Left 1122775613 14:104115847-104115869 CCCACCCCCATGCCGCAGCCCCT No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data
1122775612_1122775621 -5 Left 1122775612 14:104115846-104115868 CCCCACCCCCATGCCGCAGCCCC No data
Right 1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122775621 Original CRISPR GCCCCTCGGACTCCACACCC AGG Intergenic
No off target data available for this crispr