ID: 1122775628

View in Genome Browser
Species Human (GRCh38)
Location 14:104115891-104115913
Sequence GAGACCCACAGATGCAGCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122775618_1122775628 15 Left 1122775618 14:104115853-104115875 CCCATGCCGCAGCCCCTCGGACT No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data
1122775614_1122775628 20 Left 1122775614 14:104115848-104115870 CCACCCCCATGCCGCAGCCCCTC No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data
1122775622_1122775628 3 Left 1122775622 14:104115865-104115887 CCCCTCGGACTCCACACCCAGGC No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data
1122775623_1122775628 2 Left 1122775623 14:104115866-104115888 CCCTCGGACTCCACACCCAGGCA No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data
1122775613_1122775628 21 Left 1122775613 14:104115847-104115869 CCCACCCCCATGCCGCAGCCCCT No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data
1122775616_1122775628 17 Left 1122775616 14:104115851-104115873 CCCCCATGCCGCAGCCCCTCGGA No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data
1122775625_1122775628 -8 Left 1122775625 14:104115876-104115898 CCACACCCAGGCACTGAGACCCA No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data
1122775620_1122775628 9 Left 1122775620 14:104115859-104115881 CCGCAGCCCCTCGGACTCCACAC No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data
1122775619_1122775628 14 Left 1122775619 14:104115854-104115876 CCATGCCGCAGCCCCTCGGACTC No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data
1122775617_1122775628 16 Left 1122775617 14:104115852-104115874 CCCCATGCCGCAGCCCCTCGGAC No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data
1122775612_1122775628 22 Left 1122775612 14:104115846-104115868 CCCCACCCCCATGCCGCAGCCCC No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data
1122775611_1122775628 26 Left 1122775611 14:104115842-104115864 CCATCCCCACCCCCATGCCGCAG No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data
1122775624_1122775628 1 Left 1122775624 14:104115867-104115889 CCTCGGACTCCACACCCAGGCAC No data
Right 1122775628 14:104115891-104115913 GAGACCCACAGATGCAGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122775628 Original CRISPR GAGACCCACAGATGCAGCGA TGG Intergenic
No off target data available for this crispr