ID: 1122776046

View in Genome Browser
Species Human (GRCh38)
Location 14:104117331-104117353
Sequence CCCGCGTCGCCTGCGGATCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122776046_1122776055 -2 Left 1122776046 14:104117331-104117353 CCGGGATCCGCAGGCGACGCGGG No data
Right 1122776055 14:104117352-104117374 GGCGGTCCCAAGGGCGTCGGGGG No data
1122776046_1122776053 -4 Left 1122776046 14:104117331-104117353 CCGGGATCCGCAGGCGACGCGGG No data
Right 1122776053 14:104117350-104117372 CGGGCGGTCCCAAGGGCGTCGGG No data
1122776046_1122776060 29 Left 1122776046 14:104117331-104117353 CCGGGATCCGCAGGCGACGCGGG No data
Right 1122776060 14:104117383-104117405 TCCGCAGCTCGGCGAACCGACGG No data
1122776046_1122776054 -3 Left 1122776046 14:104117331-104117353 CCGGGATCCGCAGGCGACGCGGG No data
Right 1122776054 14:104117351-104117373 GGGCGGTCCCAAGGGCGTCGGGG No data
1122776046_1122776058 18 Left 1122776046 14:104117331-104117353 CCGGGATCCGCAGGCGACGCGGG No data
Right 1122776058 14:104117372-104117394 GGGCTCCTCTCTCCGCAGCTCGG No data
1122776046_1122776052 -5 Left 1122776046 14:104117331-104117353 CCGGGATCCGCAGGCGACGCGGG No data
Right 1122776052 14:104117349-104117371 GCGGGCGGTCCCAAGGGCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122776046 Original CRISPR CCCGCGTCGCCTGCGGATCC CGG (reversed) Intergenic
No off target data available for this crispr