ID: 1122779356

View in Genome Browser
Species Human (GRCh38)
Location 14:104137156-104137178
Sequence GTCTGCCGGCAGTGCGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122779348_1122779356 8 Left 1122779348 14:104137125-104137147 CCGGAGCAGTGGAGCGGCGGGAG No data
Right 1122779356 14:104137156-104137178 GTCTGCCGGCAGTGCGGGGTGGG No data
1122779347_1122779356 9 Left 1122779347 14:104137124-104137146 CCCGGAGCAGTGGAGCGGCGGGA No data
Right 1122779356 14:104137156-104137178 GTCTGCCGGCAGTGCGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122779356 Original CRISPR GTCTGCCGGCAGTGCGGGGT GGG Intergenic
No off target data available for this crispr