ID: 1122780182

View in Genome Browser
Species Human (GRCh38)
Location 14:104140168-104140190
Sequence CACCCTGCCCTGCCCCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 753
Summary {0: 1, 1: 0, 2: 11, 3: 69, 4: 672}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122780182_1122780189 8 Left 1122780182 14:104140168-104140190 CCTGTCTGGGGCAGGGCAGGGTG 0: 1
1: 0
2: 11
3: 69
4: 672
Right 1122780189 14:104140199-104140221 TACCAGTCTGGTTTCTGTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 138
1122780182_1122780193 22 Left 1122780182 14:104140168-104140190 CCTGTCTGGGGCAGGGCAGGGTG 0: 1
1: 0
2: 11
3: 69
4: 672
Right 1122780193 14:104140213-104140235 CTGTCCTGGGCACCGTCTCCGGG 0: 1
1: 0
2: 1
3: 18
4: 216
1122780182_1122780195 30 Left 1122780182 14:104140168-104140190 CCTGTCTGGGGCAGGGCAGGGTG 0: 1
1: 0
2: 11
3: 69
4: 672
Right 1122780195 14:104140221-104140243 GGCACCGTCTCCGGGCTCTCTGG 0: 1
1: 0
2: 0
3: 7
4: 133
1122780182_1122780190 9 Left 1122780182 14:104140168-104140190 CCTGTCTGGGGCAGGGCAGGGTG 0: 1
1: 0
2: 11
3: 69
4: 672
Right 1122780190 14:104140200-104140222 ACCAGTCTGGTTTCTGTCCTGGG 0: 1
1: 0
2: 1
3: 24
4: 231
1122780182_1122780188 -4 Left 1122780182 14:104140168-104140190 CCTGTCTGGGGCAGGGCAGGGTG 0: 1
1: 0
2: 11
3: 69
4: 672
Right 1122780188 14:104140187-104140209 GGTGGGGCAGGGTACCAGTCTGG 0: 1
1: 0
2: 2
3: 21
4: 239
1122780182_1122780192 21 Left 1122780182 14:104140168-104140190 CCTGTCTGGGGCAGGGCAGGGTG 0: 1
1: 0
2: 11
3: 69
4: 672
Right 1122780192 14:104140212-104140234 TCTGTCCTGGGCACCGTCTCCGG 0: 1
1: 0
2: 2
3: 15
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122780182 Original CRISPR CACCCTGCCCTGCCCCAGAC AGG (reversed) Intronic
900200029 1:1400322-1400344 CACCGTTCCCTGCCCCACGCAGG - Intronic
900229494 1:1549231-1549253 CACCGTGCCCGGCCCCAGGCTGG - Intronic
900292269 1:1928558-1928580 CACCCTTCCCTGCTCCCGCCTGG + Intronic
900322175 1:2090319-2090341 CACCCAGCCCTCCCGCAGAAGGG + Intronic
900366499 1:2313950-2313972 CACTCTGCCCTGCCCCTGGTGGG + Intergenic
900403742 1:2483569-2483591 CACCCTGCCCTGCCCAGCCCTGG + Intronic
900480041 1:2893859-2893881 CCCCCTCCCCTGACCCAGGCCGG + Intergenic
900521065 1:3105812-3105834 CCCCCTGCGGCGCCCCAGACAGG + Intronic
900527436 1:3136056-3136078 CCCCCAGCCCCGCCCCAGCCTGG - Intronic
901212395 1:7534042-7534064 AACCCTGCCCTTGCCCAGCCTGG + Intronic
901701670 1:11047721-11047743 CACCGTGCCCAGCCTCAGGCTGG + Intergenic
901867436 1:12116267-12116289 CACCATGCCCAGCCCCGGGCTGG + Intronic
902502816 1:16922103-16922125 CACGCTGCCCCGCCCCAGACAGG - Intronic
902634225 1:17724628-17724650 CACCTTGCCCAGCCTCAAACAGG - Intergenic
902726792 1:18341682-18341704 ACCCCTGCCCTGCCACACACTGG - Intronic
903048995 1:20587139-20587161 CACCCAGCCCTGCCCAGGCCTGG - Intergenic
903958479 1:27041258-27041280 CAGCCTGCCCAGCCACAGGCTGG - Intergenic
904145803 1:28390499-28390521 CACCATGCCCTGCCCCAGCCTGG - Intronic
904237140 1:29123162-29123184 CACCCATCCCTGCCTCCGACTGG + Intronic
904332187 1:29767342-29767364 CGCGCTGCCCTGCCCTAGGCTGG + Intergenic
904382877 1:30123388-30123410 GACCCTGGCCTGCCCAAGACTGG - Intergenic
904395313 1:30217276-30217298 CTCCCTGCTCAGCCCCAGAAAGG + Intergenic
904607507 1:31705791-31705813 CTCCCACCCGTGCCCCAGACAGG + Intergenic
904872458 1:33627375-33627397 CTCCCTGCGCTTCCCCAGAATGG - Intronic
904971927 1:34426137-34426159 CATCCTGCCCTATCCCAGCCTGG + Intergenic
905308199 1:37033343-37033365 CTACCTGCACTGCCCCAGGCGGG + Intronic
905394107 1:37656212-37656234 CACCATGCCCAGCCCCTGCCTGG - Intergenic
905560895 1:38926546-38926568 CACCGCGCCCTGCCCGAGTCAGG - Exonic
905655689 1:39684674-39684696 CCCCCTCCCCTGCCACACACAGG + Intronic
905693560 1:39959539-39959561 CACCATGCCCGGCCCCTGTCTGG + Intronic
906101878 1:43269226-43269248 CAGCCTGCCCTTCACCAGTCCGG + Intronic
906249898 1:44302863-44302885 ATCCCTGCCCTGCCACAAACAGG + Intronic
907162062 1:52378056-52378078 CACCGCGCCCCGCCCCAGCCCGG - Intronic
908607167 1:65810980-65811002 CACCCTGCAATGCACGAGACAGG - Intronic
908883386 1:68758968-68758990 CACCCTCCCATGCCCCACAGTGG + Intergenic
910187146 1:84556422-84556444 CACCGTGCCCGGCCCCAAAGTGG - Intronic
912068430 1:105777447-105777469 CACCGTGCCCGGCCCAACACAGG + Intergenic
912093671 1:106113821-106113843 AAGCCTGCCCTGCCCCCCACAGG + Intergenic
912811561 1:112799008-112799030 CACCCTGTCCTACCTCAGATGGG + Intergenic
914679636 1:149929972-149929994 CACCCTGTCCTGATCCAGATTGG - Intronic
914990959 1:152499423-152499445 AACCCGGCCCTGACCCAGAGTGG + Intergenic
915313910 1:155017587-155017609 CACCCTTCGCTGCGCCAGCCCGG - Exonic
915331711 1:155116755-155116777 CACACTGCCCTGCCCCTGCATGG - Intergenic
915991220 1:160518759-160518781 CCCCCTGCCCCACCCCCGACAGG - Intronic
918133264 1:181647043-181647065 CACCCAGCCCTTCCCTAGACTGG - Intronic
919455916 1:197819152-197819174 GAACCTGCCCTGCGCCAGAGGGG + Intergenic
919748497 1:201023033-201023055 CACCCAGCTCTGGCCCAGGCCGG - Intronic
919761578 1:201101531-201101553 CACCCGGCCCTGCCCCAGCCGGG - Intronic
920061469 1:203229707-203229729 CACCCTGTCCCACCCCAGCCAGG + Intronic
920377289 1:205516000-205516022 AACCTTGCCCTGCCCCAGCCTGG - Intronic
920512245 1:206559838-206559860 CACCCAGCCCTGCCCCTCCCTGG - Intronic
921695415 1:218203658-218203680 CCCCCGGCCCTGCCCATGACAGG - Intergenic
921724589 1:218509406-218509428 CCCTCTCCCCTGCCCCAGTCTGG + Intergenic
922168490 1:223135394-223135416 CTCCCTGCCCTGACTCAGAATGG - Intronic
922420071 1:225453708-225453730 CACCTGGCCCTGCCCTTGACAGG + Intergenic
922801239 1:228365657-228365679 GTCCCAGCCCTGCCCCAGCCTGG + Intronic
923307136 1:232698650-232698672 CACCGCGCCCGGCCCCAAACTGG + Intergenic
924220698 1:241872506-241872528 CCCCCTACCCTGCCACAGGCCGG + Intronic
924700183 1:246443578-246443600 AACCCTCCCTTGCCCCAGACTGG - Intronic
1063229996 10:4056022-4056044 CACCGTGCCCAGCCCCAGGTAGG + Intergenic
1064313529 10:14234091-14234113 CACCCTGCTCAGCCACAGACAGG + Intronic
1065186517 10:23174573-23174595 CACCCTGCCCTCCCCCAGCCCGG - Intergenic
1065200847 10:23311421-23311443 CACCGTGCCCGGCCCCAAGCTGG - Intronic
1065288351 10:24206813-24206835 GACCCTCCCCTCCCCCATACGGG - Intronic
1065767579 10:29045448-29045470 CATCTTGCCCTTCCCCAAACAGG + Intergenic
1066654755 10:37687230-37687252 CAGCCTGAGCTGCTCCAGACAGG + Intergenic
1067550446 10:47230717-47230739 CACCCATCCCAGCCCCAGTCTGG - Intergenic
1067768697 10:49108463-49108485 TACCCTGCCCTGCTCCAGGGCGG - Intronic
1067851565 10:49758312-49758334 CCCACTGCCCTGCCACAGCCCGG + Intronic
1068380174 10:56242870-56242892 CACCACGCCCAGCCCCAGCCAGG + Intergenic
1068570400 10:58621615-58621637 CACCATGCCCTGCCCCAGGCTGG - Intronic
1069382175 10:67852378-67852400 CACCGTGCCCAGCCCCAGATAGG - Intergenic
1069660102 10:70117769-70117791 CTCCCTGCCCTGCCCTGGCCTGG - Intronic
1069724015 10:70566063-70566085 CACCCTCCCCTTCCCCAGGATGG + Intronic
1069774693 10:70919584-70919606 CTCCCTGCCCTTCCCCAGGGAGG + Intergenic
1069794085 10:71041336-71041358 CTCCCTGCACTGCCCCAGGCGGG + Intergenic
1069920007 10:71810698-71810720 CTCCTAGCCCTGCCCCAGTCTGG - Intronic
1070042523 10:72795709-72795731 CACTGTGCCCGGCCCCAGAGTGG - Intronic
1070129314 10:73646110-73646132 CACCGTGCCCGGCCTCAGATTGG + Exonic
1070302055 10:75210786-75210808 AACCCTGTCCTCTCCCAGACAGG - Intronic
1070334774 10:75445648-75445670 AACTCTGCCCTGCCCCAATCAGG - Intronic
1070487287 10:76943045-76943067 CTCTCTGCCCTGCCCCAGTATGG - Intronic
1070665038 10:78336720-78336742 TTCCCTGCCCTGCTCCAGCCTGG - Intergenic
1071505716 10:86230234-86230256 CACCCTACCCCAACCCAGACTGG + Intronic
1071511496 10:86265140-86265162 CACCCTGCCCGGCCCCCCATAGG + Intronic
1073564389 10:104522650-104522672 CACCCTGCCCTGCCCCATTCAGG - Intergenic
1074428779 10:113375025-113375047 CACCTTCCCCTGGCCCAGGCTGG + Intergenic
1074870969 10:117575855-117575877 CACCCTGCCCTGCCCCACCCTGG + Intergenic
1074977302 10:118591981-118592003 CACCATGCCCAGCCCTAGAAAGG + Exonic
1075326301 10:121534681-121534703 CACCATGCCCAGCCCCAAAATGG + Intronic
1075426649 10:122347045-122347067 GCCCCTGCCCTGTCCCAGAGAGG + Intergenic
1075658273 10:124175809-124175831 CAGCCTCCCCTCCCCCAGCCTGG + Intergenic
1076131881 10:128019122-128019144 CTCCCCTCCCAGCCCCAGACAGG + Intronic
1076289679 10:129335373-129335395 CTCCATGCCCGGCCTCAGACTGG + Intergenic
1076737748 10:132466284-132466306 CAGCCCAGCCTGCCCCAGACAGG + Intergenic
1076828305 10:132981509-132981531 CGCCTTGCCATGCCCCAGCCTGG - Intergenic
1076993039 11:285457-285479 CACCCTGCCCCGTCCAGGACAGG + Intergenic
1077043171 11:533393-533415 CGCCCCGCCCCGCCCCAGCCAGG - Intronic
1077151065 11:1073375-1073397 GACCCTGACATGCCCCAGGCGGG - Intergenic
1077228317 11:1447907-1447929 CACGCTGTCCTGCCTCAGGCCGG + Intronic
1077297699 11:1833896-1833918 CTCCTTGCTCTGCCCCAGACTGG + Intronic
1077324579 11:1958264-1958286 CAGCCTCCCCTCCCCCAGCCCGG + Intronic
1077334009 11:1995303-1995325 CACCCTGCCCTCGCCTAGTCTGG - Intergenic
1077563707 11:3282694-3282716 CACCCTGAACAGCTCCAGACAGG - Intergenic
1077569597 11:3328511-3328533 CACCCTGAACAGCTCCAGACAGG - Intergenic
1078089165 11:8253255-8253277 AAGCTTGCCCTGCTCCAGACAGG - Intronic
1078571112 11:12458685-12458707 CACCCTGGGCTGCCACAGAGGGG - Intronic
1078932564 11:15923590-15923612 CACCCTGCCCTTTGCCAAACAGG + Intergenic
1079058185 11:17225504-17225526 CACCATGCCCAGCCTCAGGCTGG + Intronic
1079125308 11:17714473-17714495 CACCCTGCCCCTGCCCAGGCTGG - Intergenic
1079289262 11:19172357-19172379 CACCGTGCCCTGCCGCAGTTAGG + Intronic
1079296902 11:19241946-19241968 ACCCCTGCCCAGCCCCAGGCCGG + Intergenic
1079970725 11:27032093-27032115 CACCCTGCCCTGTCACTGATGGG + Intergenic
1080414639 11:32057927-32057949 CACCCTGCTCTGCTCCAGGAAGG + Intronic
1080637997 11:34140258-34140280 CACACAGCCCTGGCCCAGAGGGG - Intronic
1080641882 11:34162985-34163007 CACCCTGCCCTGCCTCTCAGAGG - Intronic
1081064543 11:38524137-38524159 CACCCTGACATGTCCCAGAAAGG - Intergenic
1081809244 11:45906017-45906039 CACACGGCCCTGCCCCATCCTGG + Exonic
1081811101 11:45914504-45914526 CACCTTCCCCTGCCCCAGCCTGG - Intronic
1083267646 11:61554199-61554221 CCCCAGGCCCTGCCCCTGACTGG + Intronic
1083474780 11:62908841-62908863 CCTCCGGCCCTGCCCCACACAGG - Exonic
1083569928 11:63754410-63754432 CACCGTGCCTGGCCCCACACTGG - Intronic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1083620526 11:64047190-64047212 TCCCCTCCCCTGCCCCAGAGAGG + Intronic
1083659111 11:64244030-64244052 CCCCCTGCCCCTCCCCAGTCTGG - Exonic
1083720265 11:64600394-64600416 CACCCCGCCCAGCCCCAGCACGG - Exonic
1083813943 11:65121543-65121565 CACCCCGCACTGGCCCAGAGTGG + Exonic
1083961965 11:66019563-66019585 CACCATGCCCGGCCCCAGGTAGG + Intronic
1084172291 11:67406438-67406460 CCCCCTCCTCTGCCCAAGACAGG - Intronic
1084351464 11:68603013-68603035 CTGCCTGCTCTGCCCCACACTGG + Intronic
1084464129 11:69312435-69312457 CCCCCTGCCCCGCCCCAAGCTGG - Intronic
1084636902 11:70398775-70398797 CGCCCTGCCCCGCCCCAGGCCGG - Intronic
1084677690 11:70645818-70645840 CCCCCTGCCCTGCCACAGCAGGG + Intronic
1085445503 11:76598229-76598251 CATCTTGCCCTGTCACAGACTGG - Intergenic
1085504508 11:77049439-77049461 CTCCCTGCCCTGCCGCAGATCGG - Intergenic
1085792395 11:79507252-79507274 CACCGTGCCCGGCCCAAGAAAGG + Intergenic
1088576221 11:111274210-111274232 CACCCTTCCCAGCCCCATGCAGG + Intronic
1088719480 11:112579396-112579418 CTCCCTGCCCTGACCCCCACTGG + Intergenic
1088814097 11:113409930-113409952 CTCCCTGCCAGGCCCCAGGCTGG + Exonic
1089123852 11:116162336-116162358 CACCCTGCCTCTCCCCAGGCAGG + Intergenic
1089276227 11:117337824-117337846 CACCCTGTCCTACACCAGAGGGG - Intronic
1089402490 11:118172401-118172423 CAGCCTGCCTGGCTCCAGACTGG + Intronic
1089822579 11:121241610-121241632 CTCCCTGCCCTGCTCCAATCTGG - Intergenic
1090260340 11:125314734-125314756 TGCCCTGCCCTGCCCCCGAGAGG + Intronic
1090361775 11:126177699-126177721 CACCCTGCCATCCCCTAGCCAGG + Intergenic
1090799789 11:130163198-130163220 CATCCTGCCCTGCCAAACACAGG + Intronic
1090822540 11:130356739-130356761 CACCACGCCCGGCCCCAGGCTGG - Intergenic
1091353525 11:134916193-134916215 CACCCTGCCCTCCTCCTGAGGGG + Intergenic
1202807558 11_KI270721v1_random:13441-13463 CAGCCTCCCCTCCCCCAGCCCGG + Intergenic
1202816992 11_KI270721v1_random:50485-50507 CACCCTGCCCTCGCCTAGTCTGG - Intergenic
1091400585 12:178319-178341 CACCCTGCCTTTCCCTAGAGAGG - Exonic
1091643943 12:2259229-2259251 CACCCCGCCCTGCCCCACACGGG + Intronic
1094603811 12:31933414-31933436 CACCCTGCCCCACCCCAGCAAGG + Intergenic
1096604320 12:52753946-52753968 CCCCATGCCCTGCCCTAGCCTGG + Intergenic
1096607319 12:52776191-52776213 CACCCTCCTCTGCCCCAGCATGG + Intronic
1097325096 12:58267304-58267326 CACCCTGCCCTGTGCCAGAAAGG + Intergenic
1097661539 12:62436027-62436049 CACCCCTCACAGCCCCAGACAGG - Intergenic
1098172863 12:67764205-67764227 CAGCCTTCCCTACCCCATACAGG - Intergenic
1098235886 12:68417814-68417836 AGCCCTGCCCTGCCCAAGAGGGG + Intergenic
1100467029 12:94855449-94855471 CACTGTGCCCTGCCCAGGACAGG - Intergenic
1101882543 12:108635193-108635215 CACCGTGCCCAGCCGCACACAGG + Intergenic
1102112338 12:110373924-110373946 CATCCTCCCCTGCTCCAGCCAGG - Exonic
1102159769 12:110759127-110759149 CACTCTGCCCAGCCCCCTACCGG - Intergenic
1102399259 12:112614393-112614415 CACCATGCCCAGCCCCACAAAGG - Intronic
1102507772 12:113394626-113394648 CACCATGCCCGACCCCAGGCTGG + Intronic
1102814493 12:115853369-115853391 CACCCTGAGCTTCCCCAGAGAGG - Intergenic
1102896054 12:116599513-116599535 CAGCCTCCCCTGGCCCAGATTGG - Intergenic
1103014400 12:117482540-117482562 CTCCCACCCCTGCCCCAGCCAGG - Intronic
1103209872 12:119158060-119158082 CTCTCTGCCCAGCCCCAGCCAGG - Exonic
1103780626 12:123396453-123396475 CACCCTGCCCCTCCACAAACTGG - Intronic
1103896133 12:124274477-124274499 CGCCCTCCCCTCCCCCAGAAGGG - Intronic
1104004051 12:124879844-124879866 CACCATGCCCTGCCAAACACAGG + Intronic
1104536742 12:129624733-129624755 CACTCTGCCCTGTGCCTGACAGG - Intronic
1104713437 12:131001753-131001775 CACCCTTCTCTGCCCCTGCCTGG - Intronic
1104768517 12:131345893-131345915 CCTCCTGCCCTGCCCCAGGAGGG + Intergenic
1104965265 12:132506102-132506124 CCCCCTGCTCAGCCCCAGACAGG - Intronic
1105027527 12:132858992-132859014 TGCCCAGCCCTGCCCCACACGGG + Intronic
1105508448 13:21031561-21031583 CACCACACCCAGCCCCAGACAGG - Intronic
1105687230 13:22796033-22796055 CACCATGCCCAGCCTCAGAATGG + Intergenic
1105697837 13:22907979-22908001 CACCGTGCCCAGCCTCAGAATGG - Intergenic
1105780158 13:23698733-23698755 CACCGTGCCCGGCCCCAGCTAGG + Intergenic
1106499038 13:30309426-30309448 CACCTGGCCCTGCCCTTGACAGG - Intergenic
1106777012 13:33017791-33017813 TTCCCTGCCCTGCCGCAGAAGGG - Intronic
1106923396 13:34588580-34588602 TACCCTGCCCTGCCCACGCCTGG - Intergenic
1107840118 13:44449164-44449186 CAGCCTGCCCAGCCTCAGAAAGG - Intronic
1108120779 13:47183727-47183749 AACCCTGCCCTGACCCTTACAGG - Intergenic
1108402769 13:50064763-50064785 CACCTTGCCCTGCCTAAGATGGG - Intergenic
1109617342 13:64852578-64852600 CCCACTGCTCTGCCCCAGCCCGG + Intergenic
1110638336 13:77791591-77791613 CTCCCTGCTCAGCCCCAGGCTGG - Intergenic
1110856519 13:80302977-80302999 CACCGCGCCCTGTCCGAGACGGG + Intergenic
1112494219 13:99893123-99893145 CACGCTGGGCTGCCCCAGAGCGG + Exonic
1113417670 13:110141350-110141372 CACACTGCCCACACCCAGACAGG + Intergenic
1113707523 13:112444296-112444318 CATGCTGCCTTGCCCCACACAGG + Intergenic
1113718040 13:112528096-112528118 TCCCCTGCCCTGACCCTGACGGG + Intronic
1113737494 13:112689448-112689470 CACCCTCCCCTCCCACTGACAGG + Intergenic
1113838298 13:113343854-113343876 CACTCTGCCCTTCCCCAGCCTGG - Intronic
1114569000 14:23652734-23652756 CACTGTGCCCGGCCGCAGACTGG + Intergenic
1114613492 14:24056574-24056596 CCCACTGCCCTGCCCCTCACTGG + Intronic
1115241202 14:31252517-31252539 CACCATGCCCGGCCTCAGACTGG - Intergenic
1115670949 14:35611205-35611227 CACCATGCCCGGCCCCAGGCTGG - Intronic
1117066057 14:52014249-52014271 CACGCAGCCCTGCCCCCTACAGG + Intronic
1119569186 14:75655084-75655106 CATCCTGCCCAGCCACAGAGAGG - Intronic
1119713627 14:76842416-76842438 CACCCAGTCCTATCCCAGACTGG + Intronic
1120139430 14:80911928-80911950 CACCGTGCCCTGCCCGGGAGTGG - Intronic
1120383998 14:83820520-83820542 CACCGTGCCCTGCCAAAGCCAGG + Intergenic
1120619897 14:86750709-86750731 CACCCACCCCTTCCCCAGCCAGG + Intergenic
1121300976 14:92870722-92870744 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1121301175 14:92872503-92872525 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1121301309 14:92873653-92873675 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1121318076 14:92974016-92974038 CACCCTGCCCTCCTGCAGATTGG + Intronic
1121326106 14:93020453-93020475 CACCCTTCCCTGCACCTCACAGG + Intronic
1121486646 14:94321492-94321514 TGCCCTGCCCTGCCCCACAGTGG - Intronic
1121652178 14:95566658-95566680 CACCCTGCCCGGCCCCACCAAGG - Intergenic
1122053145 14:99073852-99073874 CACCCTGGCCTAGCCCAGAGAGG + Intergenic
1122123994 14:99569427-99569449 CAGGCTGCCCTGCCCCACAGAGG + Intronic
1122593501 14:102872284-102872306 CAGACAGCCCTGCCACAGACAGG - Intronic
1122611211 14:102984747-102984769 GAGCCTGGCCTTCCCCAGACAGG - Intronic
1122774929 14:104112922-104112944 CACCCTGCCTTTGCCCAGGCTGG + Exonic
1122780182 14:104140168-104140190 CACCCTGCCCTGCCCCAGACAGG - Intronic
1122813968 14:104303300-104303322 AGCCCGGCCCAGCCCCAGACAGG + Intergenic
1122857235 14:104565790-104565812 CACCCTCTCCTTCCCCAGAGAGG + Intronic
1122949042 14:105030623-105030645 CACCATGCCCAGCCCCAAAAGGG - Intergenic
1122969388 14:105146343-105146365 CGCCCTGCCCTACCCGAGGCTGG - Intronic
1123007912 14:105333304-105333326 TCCCCTGGCCTGCCCCAGGCGGG + Intronic
1123043192 14:105498974-105498996 AAGCCTGCCCTGGCCCAGCCTGG + Exonic
1202853447 14_GL000225v1_random:36142-36164 CAGCCTGCCCCACCCCAGAAGGG - Intergenic
1123697590 15:22890470-22890492 CACCCCACCCTGCCCCACAGAGG + Intronic
1123807371 15:23888647-23888669 CACCATGCCCGGCCCCTCACAGG + Intergenic
1124342776 15:28900916-28900938 CCCACTGCCCTGCCCCTGGCTGG + Intronic
1124472838 15:30003520-30003542 CCCCCTGCCCCGCCCCATTCAGG + Intergenic
1124504445 15:30261234-30261256 CATCCTGCTCTGCCCCCGGCTGG + Intergenic
1124739106 15:32277401-32277423 CATCCTGCTCTGCCCCCGGCTGG - Intergenic
1124905078 15:33860800-33860822 CACCCTGCCATACCCCTGCCAGG + Intronic
1125081332 15:35677241-35677263 CACTGTGCCCGGCCCCACACAGG - Intergenic
1125597032 15:40893932-40893954 CGCCCTGACCTGCCCCACAGTGG - Intergenic
1126506173 15:49406678-49406700 CACCCTGCCCTGCCACTGCTGGG - Intronic
1126615681 15:50577101-50577123 CCCCCTCCCCTGCCAAAGACAGG - Intronic
1126653699 15:50953491-50953513 CATCCTGCTCTGCCCCAGCTGGG + Intronic
1126948897 15:53857082-53857104 CACCGTGCCCGGCCCCAATCTGG + Intergenic
1127267999 15:57376579-57376601 CACCCCGCCCCGCTCCAGCCCGG - Intronic
1127690896 15:61396292-61396314 CCCCCTGCCCTGCCCCATCAAGG - Intergenic
1127915362 15:63450776-63450798 CACCGTGCCCGGCCCCACATGGG + Intergenic
1127994323 15:64144297-64144319 CCCTCTGCCCTACCCCGGACTGG + Intronic
1128149384 15:65353536-65353558 CACCGTGCCCGGCCTCAGATGGG + Intronic
1128156943 15:65396985-65397007 CTCCCTCTCCTTCCCCAGACGGG - Exonic
1128499426 15:68217516-68217538 CACCATGCCCGGCCCCAAAAGGG + Intronic
1129298479 15:74612508-74612530 CACCCTGCCCTGGCTCTGAAAGG + Intronic
1129419291 15:75410759-75410781 CACCGTGCCCGGCCTCAGTCAGG - Intronic
1129833716 15:78688173-78688195 CAACATGCCCTGCCCCACAATGG - Intronic
1130009312 15:80136176-80136198 CACCATGCCCAGCCCTAGAAAGG - Intronic
1130028881 15:80294313-80294335 CACCACGCCCGGCCCCTGACAGG + Intergenic
1130192222 15:81748406-81748428 CACCCTTCCCTGCTGCTGACAGG + Intergenic
1130650513 15:85759807-85759829 CACCCTGCCCAGTCCCTGTCAGG + Exonic
1130695610 15:86128363-86128385 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1131116229 15:89797759-89797781 CACCCAGCCCAGCCACAGCCTGG + Intronic
1131956457 15:97741054-97741076 CTCTCTGCACAGCCCCAGACTGG + Intergenic
1131969933 15:97881725-97881747 CTTCCTGTCCTTCCCCAGACAGG - Intergenic
1132662710 16:1068773-1068795 CCCCCTGCCCTGCCCAGCACAGG + Intergenic
1132836967 16:1959010-1959032 CTCCCTGCCCTCCCCCAGACAGG + Intergenic
1132839956 16:1974111-1974133 CCCACTGCCCTTCCCCAGGCTGG - Intronic
1132866769 16:2097052-2097074 CACCCCACCCTACCCCAGGCGGG + Intronic
1134100805 16:11450052-11450074 CACCCAGCCCTGCCTCAGAGGGG + Intronic
1134610350 16:15603460-15603482 CACCTTGCCGGGCCCCAGAATGG + Intronic
1136020355 16:27436213-27436235 CACCGTGTTCTGCCCCAAACAGG + Intronic
1136103867 16:28014939-28014961 GCCCCTGCCCTGCCCCAGCCAGG + Intronic
1136344455 16:29665788-29665810 CACCCAGCCATGCTCCAGGCTGG - Exonic
1136520916 16:30795150-30795172 CACCGTGCCCGGCCCCATACTGG - Intergenic
1137480845 16:48850629-48850651 CACGCAGCCCTGGCCCAGCCCGG + Intergenic
1137674955 16:50299571-50299593 GGCCCTGCTCTGCCCCACACTGG - Intronic
1137785241 16:51133218-51133240 CACCCTTCCCCAACCCAGACCGG + Intergenic
1138131396 16:54482819-54482841 GACACTTCCCTGCCCCAGAAAGG - Intergenic
1138223151 16:55270154-55270176 CCCTCTGCCCTGCCCCACCCTGG - Intergenic
1138381810 16:56607895-56607917 CACCCTGCTCTGCCACTCACTGG + Intergenic
1138453517 16:57107450-57107472 CACCCTGGCCTCCTGCAGACCGG + Intronic
1138657519 16:58499751-58499773 CACCCTGCCCTGCCCCGCATTGG + Intronic
1139910489 16:70394664-70394686 CACCATGCCCTGCCTCTGATGGG + Intronic
1140088606 16:71818685-71818707 CACCGCGCCCGGCCCCAAACCGG + Intergenic
1140286286 16:73605894-73605916 CACTGTGCCCTGCCCCAGCATGG - Intergenic
1140688910 16:77462553-77462575 CACCCCTTCCTGCCCCAAACAGG - Intergenic
1140884238 16:79228925-79228947 CACCGTGCCCTGTCTCAGACTGG - Intergenic
1142020645 16:87780105-87780127 CACCGTGCCCGGCCTGAGACAGG + Intergenic
1142119112 16:88377223-88377245 CCCCCTGCCCTGCACCACCCCGG - Intergenic
1142284241 16:89165289-89165311 CACCCTGGCCTCCTCCAGTCTGG + Intergenic
1142480401 17:215244-215266 CACCCTGCCCTGCACCTGCTGGG - Intronic
1142564700 17:832471-832493 CACCATGCCCAGCCTCAGCCAGG + Intronic
1142813582 17:2408294-2408316 CCCCCAGCCCCGCCCCAGGCTGG - Intronic
1144344751 17:14339776-14339798 CAGCCTGTCCAGCCCCAGGCTGG - Intronic
1144505122 17:15822877-15822899 CACCCTGGACTACCGCAGACTGG - Intergenic
1144510408 17:15870348-15870370 CACCCTGCCAGGCCCCAAATAGG - Intergenic
1144534592 17:16075677-16075699 ACCCCGGCTCTGCCCCAGACTGG - Exonic
1144846731 17:18224174-18224196 GTCCCTGCCCTGCCTCACACAGG - Intergenic
1145174566 17:20688073-20688095 CACCCTGCCAGGCCCCAAATAGG - Intergenic
1146056036 17:29581683-29581705 CCACCTGCCCAGCCCCAGCCAGG + Intronic
1146290889 17:31606368-31606390 CATCCCACCCTGGCCCAGACAGG - Intergenic
1147134079 17:38425335-38425357 CACTCTCCCCTGCCCCATCCAGG + Intergenic
1147167246 17:38600252-38600274 TACCCAGCCCTGCCCCAGGACGG + Intronic
1147186130 17:38713907-38713929 CACCCTGCACTGCCCCTCCCGGG - Intronic
1147190131 17:38733611-38733633 CACTCCCGCCTGCCCCAGACTGG - Exonic
1147318434 17:39632136-39632158 TCCCCAGCCTTGCCCCAGACTGG - Intronic
1147420161 17:40318503-40318525 CCCCATGTCCTGCCCCAGATTGG + Intronic
1148180302 17:45600551-45600573 CACACGGCCCTGCCCCATCCTGG - Intergenic
1148268598 17:46245343-46245365 CACACGGCCCTGCCCCATCCTGG + Intergenic
1148395219 17:47302859-47302881 CTCCCGGCCCTGCCCCAGGAGGG + Intronic
1148907317 17:50919669-50919691 AACCCAGCCCTACCCCTGACTGG - Intergenic
1148927604 17:51101057-51101079 CACCATGCCCAGCCCCATAAGGG - Intronic
1150213462 17:63454154-63454176 CACCCTGCCCTGCTCCCAAGGGG + Intergenic
1150460521 17:65346393-65346415 CACCCAGCCCTGGCCCACCCTGG - Intergenic
1150579891 17:66463052-66463074 CACCCAGCACTGCTCCAGGCCGG - Intronic
1150648897 17:66997212-66997234 CACACTGCCCTGCCCTAGTTTGG - Intronic
1150650156 17:67005010-67005032 CACCCTGCCCCGTCCCAAAGAGG + Intronic
1151539698 17:74758758-74758780 AACCCAGCCCTGCCCCAGCTTGG + Intronic
1151698634 17:75730995-75731017 CTTCCTGCCCTGCCCCAGAAGGG - Intronic
1151789115 17:76292752-76292774 CACCCTGACCTGTGCCAGATTGG + Exonic
1151836593 17:76586149-76586171 CGCCCTGCCCAACCCGAGACTGG - Intronic
1152214178 17:79022969-79022991 CCCACTGCCTTGCCCCAGGCTGG - Intronic
1152374450 17:79911911-79911933 CGCCCTGCCCCGCCCCATCCTGG + Intergenic
1152702361 17:81825395-81825417 CAGCCTGCCCTGCTCCAGAGGGG + Exonic
1152792120 17:82286485-82286507 CACCGTGCCCAGCCTCCGACTGG - Intergenic
1154415583 18:14173807-14173829 GGCCCTGCCCTGGCCCAGCCTGG - Intergenic
1155193279 18:23450270-23450292 CATCCTGCCCTGCCCCCATCTGG + Intergenic
1155193625 18:23453094-23453116 TGCCCTGCCCTGCCCGACACAGG + Exonic
1156352831 18:36315715-36315737 CAGCCTGCCTTGCACCAGGCTGG + Intronic
1156463529 18:37334710-37334732 CACCCTGCCCTGACCCGGGGGGG + Intronic
1156645483 18:39156396-39156418 CAGCCTGCCCAGGCCAAGACTGG - Intergenic
1157478290 18:48037092-48037114 CACCCTGCCTTTCCCCAGCTCGG + Intronic
1158198753 18:54916811-54916833 CACCTGGCCCTGCCCTTGACAGG - Intronic
1158446169 18:57523597-57523619 CAGACAGCCCTGCCCCAGGCTGG + Intergenic
1158805345 18:60964946-60964968 CACCGTGCCCGGCCTCTGACTGG + Intergenic
1159606069 18:70476724-70476746 CACCGTGCCCGGCCTCAGAATGG - Intergenic
1159644866 18:70905869-70905891 CATCCTTCACTACCCCAGACTGG + Intergenic
1160018292 18:75160640-75160662 CCCCCTGGCCAGCCGCAGACAGG - Intergenic
1160161744 18:76478765-76478787 CACCATGCCCAGCCCCACAGTGG - Intronic
1160375148 18:78405952-78405974 CACCCTACACTGCACCGGACAGG - Intergenic
1160404820 18:78638141-78638163 CGCCCTCCCCAGCCCCAGGCCGG - Intergenic
1160505194 18:79422972-79422994 TGCCCTGCCCTGCCCCGGATGGG - Intronic
1160518297 18:79490293-79490315 CACCCTGTCCTAACCCAGAGCGG - Intronic
1160741609 19:688885-688907 CACCACGCCCGGCCCCACACAGG + Intronic
1160772724 19:840346-840368 CACCCTGCAGTGCCCAGGACGGG - Intergenic
1160921195 19:1521593-1521615 TCCCCCGCCCTGCCCCAGGCTGG - Intergenic
1161023261 19:2021744-2021766 CACCTGGCCCAGCCCCAGGCTGG + Intronic
1161075811 19:2285113-2285135 ATCCCTGCCCTGCCCCGTACTGG - Intronic
1161123904 19:2545260-2545282 CACCCTGCAGTGCCCAGGACAGG + Intronic
1161174240 19:2831052-2831074 CACTGTGCCCAGCCCCATACTGG + Intronic
1161588054 19:5116110-5116132 TACCATGCCCAGCCCCAGTCTGG - Intronic
1161592260 19:5134147-5134169 CACCCTGCCCTGCGTGAGAGAGG - Intronic
1162017210 19:7852176-7852198 CGCCTTGCCCCGCCCCAGCCCGG + Intronic
1162134693 19:8548182-8548204 CACCCTGGGCTGCCCCAGGGAGG + Intronic
1162136173 19:8556597-8556619 CACTGTGCCCGGCCCCAGATTGG - Intronic
1162421555 19:10568677-10568699 CCCCCCGCCCCGCCCCAGCCCGG + Exonic
1162716312 19:12636651-12636673 TACCCTGCCCCGCCCCATCCTGG + Intronic
1162763136 19:12900352-12900374 CACCCAGCCCTGACCCCGCCAGG - Intronic
1162772459 19:12957277-12957299 CGCCCTGCCCTGGCCCACACCGG - Intergenic
1162922730 19:13913046-13913068 CAGCCTCCCCTGCCCCAGTGAGG - Intronic
1162971504 19:14183693-14183715 CTCCCTGTCCTCCCCCAGGCTGG - Exonic
1162981439 19:14242799-14242821 CACCATGCCCTGCCCCAGTCTGG - Intergenic
1163112419 19:15169818-15169840 CATCCTGCCCCTCCCCAGCCAGG - Intronic
1163266875 19:16227117-16227139 GGCCCTGCCCAGCCCCAGGCGGG - Intronic
1163555131 19:17987703-17987725 TACCATGCCCAGCCCCAGGCAGG - Intronic
1163852166 19:19670270-19670292 CACCCTGAGCTGCCTCAGAAGGG - Intronic
1164210464 19:23093572-23093594 CCCCCAGCCCTGTCCCAGCCCGG - Intronic
1164702529 19:30295988-30296010 TAACCTGCCCTGCCCGACACTGG - Intronic
1164747955 19:30629798-30629820 TCCCCTGCCCGGCCCCAGAAGGG - Intronic
1164854336 19:31509502-31509524 CACCCTGCCTGGCCCCAGGGTGG - Intergenic
1165391131 19:35539599-35539621 GACCCTGCCTGGGCCCAGACAGG - Intronic
1165620882 19:37246480-37246502 CACCGCGCCCAGCCTCAGACTGG - Exonic
1165722808 19:38091607-38091629 CACCCTGCCCTGCCACTCCCTGG - Intronic
1165782532 19:38442581-38442603 CTCTCTGCCCTGCCCCCCACAGG + Intronic
1166121005 19:40686880-40686902 AGCCCTGCCCTGTCCCAGGCTGG + Intronic
1166197867 19:41218854-41218876 CCCCCAGCCCAGCCCCAGCCAGG - Intergenic
1166981392 19:46634295-46634317 CACCTTGCCCCGCCCCATACAGG + Intronic
1166996715 19:46722992-46723014 GACCCAGCCCTGCCCCAGGGTGG + Intronic
1167281021 19:48568612-48568634 CGCCCTGCCCTGCCTCTGTCCGG - Intronic
1167336238 19:48887844-48887866 CACTGTGCCCAGCCCCAGGCTGG + Intronic
1168522148 19:57060907-57060929 CACCCTCCCCTGCTCCAGTCTGG + Intergenic
925365640 2:3309984-3310006 CTCCCTGCGCTGCTCCAAACTGG + Intronic
925875696 2:8309442-8309464 CATCCTGCCCTGGCCCTGGCCGG - Intergenic
926010211 2:9400927-9400949 AGCCCCGCCCTGCCCCAGCCAGG - Intronic
926298334 2:11584394-11584416 CTCCCCTCCCTGCCCCAGCCTGG - Intronic
926913344 2:17871655-17871677 CTCCCTTCCTTGCCCCAGGCGGG + Intergenic
927155329 2:20217960-20217982 CAGCCTGCCCTGCCCTCCACTGG + Intronic
927787296 2:25982568-25982590 CCCCCTGCCCCACCCCAGTCGGG - Intronic
929746534 2:44665357-44665379 CACCGTGCCCGGCCTCAGAGAGG + Intronic
929924708 2:46198566-46198588 CACCCTGCCCACCCCCATCCTGG - Intergenic
930075141 2:47400437-47400459 CACCCCGCCCAGCCTCAGCCTGG - Intergenic
930103111 2:47618119-47618141 CTCCCTTCCCTTCCCCAGAAGGG - Intergenic
930663779 2:54082050-54082072 CCCCCTGTCCTGCCCCAGCCTGG + Intronic
931597466 2:63965186-63965208 CACCATGCCCAGCCCCACATTGG - Intronic
931618561 2:64186931-64186953 CCCACAGCCCTGCCCCTGACTGG - Intergenic
932134157 2:69213938-69213960 CCCCCTCCCATGCCCCACACTGG - Intronic
932193581 2:69763184-69763206 AACCCTGCCCTGGCCCAGAGAGG + Intronic
932271854 2:70418178-70418200 CTCCCTCCCCTACCCCAGCCTGG + Intergenic
932887120 2:75558558-75558580 CTCCCTGCCCTGCCCCAGGTTGG - Intronic
933727535 2:85435251-85435273 CACCCCGCCGTGCCCCAGACAGG + Intronic
934526860 2:95057359-95057381 CACCCTGCCCTGCACAAGGAAGG - Intergenic
934713881 2:96532071-96532093 CACTCAGCCCTGCCCCCGGCGGG - Intergenic
934753094 2:96806918-96806940 CACCCTGACCCGCCCCGGCCAGG + Intronic
934907787 2:98220964-98220986 CCCTCTGCCCCGCCCCCGACAGG - Intronic
935000682 2:99011418-99011440 CACCATGCCCGGCCAAAGACAGG + Intronic
935707691 2:105870797-105870819 CACCCTGAATTTCCCCAGACTGG - Intronic
935734113 2:106092612-106092634 TCCTCTGCCCTGCCCAAGACTGG + Intergenic
936061063 2:109296059-109296081 ATCCCTTCCCTGCCCCAGCCAGG + Intronic
936998282 2:118437794-118437816 CCTGCTGCCCTCCCCCAGACAGG - Intergenic
937956166 2:127422838-127422860 CCCGCTGCCCTGCCCCACCCGGG + Intronic
938056086 2:128215737-128215759 CATCATGCCCAGCCCCAGAATGG - Intergenic
938097934 2:128475490-128475512 CTGCCCGCCCTGCCCCAGGCAGG + Intergenic
938219873 2:129556891-129556913 GACCCTGCCCTGTCCCTCACAGG + Intergenic
938292234 2:130156368-130156390 GAACCTGCCCTGCACCAGACAGG + Intronic
938464315 2:131516599-131516621 GAACCTGCCCTGCACCAGACAGG - Intergenic
938662981 2:133506417-133506439 CACCCTTCCCTGCCCTGGTCTGG + Intronic
940894069 2:159063533-159063555 CATCCTCCCCTCCCCCAGACTGG - Intronic
941254799 2:163215041-163215063 CACCGTGCCCGGCCCTAGAAAGG + Intergenic
942542145 2:177025576-177025598 TCACCTGCCCTGCCCCAGATTGG - Intergenic
942666511 2:178325050-178325072 CAGCCTGCTCTTCCTCAGACTGG + Intronic
942959221 2:181810138-181810160 CACCGTGCCCAGCCCAAGATTGG - Intergenic
943667990 2:190630491-190630513 CACCCTGCCCTGCCAGACAAGGG + Intergenic
943749843 2:191500071-191500093 CAGCCAGCCCTGCCTCTGACAGG - Intergenic
943756338 2:191561040-191561062 CACCCTGCCCGGCCCCAAATAGG - Intergenic
945948150 2:216013695-216013717 CTCCCCGCCCTCCCCCAGCCCGG - Intronic
946187949 2:217991785-217991807 CACCATCCCCTGCCCCAGCCCGG + Intronic
946285138 2:218697172-218697194 CACCAAGCCCTGAGCCAGACTGG + Exonic
946355654 2:219182706-219182728 CACACTGCCCCACCCCAGAGTGG - Exonic
946427774 2:219608513-219608535 CACTCTGCCCTCCCCCGAACTGG - Intronic
947913511 2:233817868-233817890 CACCCTCCCCTTCCCCAAATGGG + Intronic
947935339 2:233999138-233999160 TGCCCTGCCCTGCCCCAGGAGGG - Intronic
948206975 2:236167675-236167697 CGCCATGCCCTGCGCCAGGCTGG + Exonic
948633400 2:239317008-239317030 CACCCCACCCTGCCCCAGCGTGG - Intronic
948795996 2:240402334-240402356 GACCCTGCCCTGTACCAGCCGGG + Intergenic
948936310 2:241167117-241167139 CACCCTGCTCTGCCCCAGTGCGG + Intronic
1169194729 20:3677037-3677059 CTCCCAGCCCTACCCCAGCCTGG + Intronic
1169216518 20:3797382-3797404 CACCTTGCCCTGCTCCTGAGAGG + Intronic
1169445992 20:5671515-5671537 CACCATGCCCTGCTCCAGATTGG + Intergenic
1171767637 20:29298871-29298893 CACCCGGCCCAGACACAGACAGG - Intergenic
1171782034 20:29427959-29427981 CCCCCTGCCCTGCCCCTGGCGGG + Intergenic
1172098004 20:32470026-32470048 GGCCCTGACCTGCCCCAGCCAGG + Intronic
1172248601 20:33463259-33463281 CCCCCTACCCTGCCCCACGCAGG + Intergenic
1172444133 20:34984441-34984463 CAGCCTCCTCTGCCCCAGCCCGG - Intronic
1173206895 20:41002338-41002360 CACCATGCCTGGCCCCACACTGG + Intergenic
1173358105 20:42314238-42314260 CACCGTGCCCAGCCCCAAAGTGG - Intronic
1173425961 20:42943724-42943746 CACTGTGCCCTGCCCCAGGAAGG - Intronic
1173468287 20:43301898-43301920 AACTCAGCCCTGCCCCAGGCAGG + Intergenic
1173859611 20:46274270-46274292 CAGCCTTCCCAGCCCCAGAAAGG - Intronic
1174181747 20:48679494-48679516 TACCCTGCCCTGCCCCGTCCTGG - Intronic
1174338726 20:49882962-49882984 CACCAGGACCTTCCCCAGACAGG - Intronic
1174470976 20:50760622-50760644 CCACCTGCCCTGCCCCACTCTGG - Intergenic
1175012177 20:55749150-55749172 CCCCCTGCCCCACCCCTGACAGG - Intergenic
1175107483 20:56625650-56625672 CCCCCTGCCCTGCCCCGGGGGGG - Intergenic
1175516900 20:59575821-59575843 CCATCTGCCCTGCCCCACACTGG - Intergenic
1175613704 20:60374108-60374130 CACCTGGCCCTGCCCTTGACAGG - Intergenic
1175909283 20:62396960-62396982 CACCCAGCGCTGCCTGAGACTGG + Intronic
1175932532 20:62499381-62499403 TGCCCTGCCCTTCCCCAGGCAGG - Intergenic
1175955102 20:62605069-62605091 CTCCCTCCCCTGCAGCAGACAGG - Intergenic
1176210774 20:63920238-63920260 CACCCTGCCCTGCTCCCTGCTGG - Intronic
1176423467 21:6533622-6533644 CACCCTGCCCTGACACCGCCCGG - Intergenic
1176519970 21:7817159-7817181 AAACCTGCCCTGCCTCAGTCTGG + Exonic
1176520685 21:7821886-7821908 CACCCTGTCCTGTCAGAGACTGG + Intronic
1177174431 21:17689147-17689169 CACCCAGCCCTGCCCCCACCTGG - Intergenic
1177444282 21:21171587-21171609 CACCCTTGACTGCCACAGACTGG + Intronic
1178544622 21:33482240-33482262 CATGCTGCCCTGGCACAGACAGG + Intergenic
1178653998 21:34447172-34447194 AAACCTGCCCTGCCTCAGTCTGG + Intergenic
1178654708 21:34451898-34451920 CACCCTGTCCTGTCAGAGACTGG + Intergenic
1178951668 21:36990475-36990497 CACCCTGCCCTGCGGAAGGCAGG + Intergenic
1179114772 21:38480149-38480171 CATCCTGCCCTGCTCCACCCAGG - Intronic
1179590276 21:42403552-42403574 CCCCCTGCCCTGACCCACCCTGG - Intergenic
1179698961 21:43141938-43141960 CACCCTGCCCTGACACCGCCCGG - Intergenic
1179908692 21:44436964-44436986 GACACTGCCCCGCCCCAGGCAGG + Intronic
1179930774 21:44569517-44569539 CACACACCCCTGCCCCAGCCAGG - Intronic
1180064280 21:45405030-45405052 CCCCCTGCCCGGCCCCTGCCCGG + Intergenic
1180064312 21:45405091-45405113 CCCCCTGCCCGGCCCCTGCCCGG + Intergenic
1180225641 21:46390538-46390560 CACCCTGGCCTGGCCCTGCCTGG + Intronic
1180624646 22:17186093-17186115 AACCCTGCCCTGCCCCATGCAGG - Intronic
1180633068 22:17243294-17243316 CACCGTGCCCAGCCTCGGACTGG - Intergenic
1180752476 22:18134092-18134114 CACCATGCCCAGCCCCAGCCCGG - Intronic
1180840190 22:18955453-18955475 CACCCTGTCCTGCCCCACGGGGG + Intergenic
1180847772 22:18993737-18993759 GGCCCTGCCCTCCGCCAGACTGG - Intergenic
1180862963 22:19097766-19097788 CCACCTGCCCTGCCCCAGGCTGG + Intronic
1180865915 22:19119817-19119839 CACCCTGCCCTGTACCAGAGAGG + Intronic
1181175578 22:21032892-21032914 CACCCAGCTGGGCCCCAGACAGG + Intergenic
1181434503 22:22902516-22902538 CACACAGCCCTGACCCAGCCTGG - Intergenic
1181464752 22:23104915-23104937 CACTCTGCCCTGGCCAACACTGG - Intronic
1181602451 22:23960532-23960554 CTCCCTGCCCTGCCACATTCCGG + Intronic
1181606062 22:23980775-23980797 CTCCCTGCCCTGCCACATTCCGG - Intronic
1181669685 22:24420340-24420362 TTCCCTGCCCAGCCCCAGGCAGG - Intronic
1182548402 22:31088614-31088636 CCCCATCCCCTGCCCCAGCCTGG - Intronic
1182593102 22:31397446-31397468 CACTGTGCCCAGCCCCAGCCTGG + Intergenic
1184127865 22:42500541-42500563 CGCCCCGCCCCGCCCCAGTCAGG - Intergenic
1184148440 22:42624788-42624810 CACCCCGCCCTTGCCCAGCCTGG - Intronic
1184173281 22:42772046-42772068 CACCGTGCCCGGCCCCAGTGTGG + Intergenic
1184210293 22:43031325-43031347 CACCATGCCCGGTCCCAGAGAGG - Intergenic
1184253507 22:43274403-43274425 AACCCTGCCCTGCCCTCCACAGG + Intronic
1184474334 22:44712423-44712445 GACCCTGCCCTGCGCCAGCGAGG + Intronic
1184479176 22:44737094-44737116 CTCCCTGCCCCGCTCCAGCCCGG + Exonic
1184525807 22:45021662-45021684 CCCCCCGCCCCGCCCCCGACAGG + Intergenic
1185057541 22:48588697-48588719 GGCCCTGCCCTGCCCCAACCGGG - Intronic
1185083781 22:48724865-48724887 CTCCCTGCCATGCCGCAGGCTGG - Intronic
1185124293 22:48997780-48997802 CACCGTGCCCGGCCCAAGGCAGG - Intergenic
1185331058 22:50252218-50252240 TGCCCTGCCCTGCCCCTCACTGG + Intronic
1185419870 22:50729267-50729289 CACCAGTCCCTGCCCCATACAGG - Intergenic
950008400 3:9705424-9705446 CACCCAGCCCCACCCCACACCGG + Intronic
950136572 3:10585207-10585229 CACCCTGCCCGGCCTCTCACTGG - Intronic
950393854 3:12718575-12718597 CACCGCGCCCGGCCCCAGGCTGG + Intergenic
950487454 3:13281916-13281938 CCCCTTGTCCTGCCCCAGATGGG + Intergenic
950551876 3:13671012-13671034 CACCCTTCCCTGCCCAAGCAGGG - Intergenic
951952908 3:28220850-28220872 CTCACTGGCCTGCCCCAGTCTGG + Intergenic
952473531 3:33681874-33681896 CACTCTTCCCTGCCCCAGGGAGG - Intronic
952923913 3:38307732-38307754 CACCCTGCCCTGCCCCATTGAGG - Intronic
953606328 3:44415486-44415508 CACCCAGCACGGCCCCAGGCAGG + Intergenic
953883298 3:46702377-46702399 CACCCTTCCTGGCCCCAGCCAGG - Intronic
954375993 3:50194369-50194391 CTCCCCGCACTGCCCCAGATGGG - Intronic
955141079 3:56270689-56270711 CACCATGCCCTGCCCATGGCTGG - Intronic
955572022 3:60318078-60318100 CACCATGCCCCGCCCCATTCTGG + Intronic
955790901 3:62587853-62587875 CACCCTGCCATGCCTCTGACAGG + Intronic
955930779 3:64054705-64054727 CACCCCACCCTGCCCCACCCCGG + Intergenic
957527365 3:81394380-81394402 CACACTGTCCTGTACCAGACAGG + Intergenic
957956606 3:87196206-87196228 CACCAGGCCCTGCCCCAGTGGGG - Intergenic
958785722 3:98594184-98594206 CACCGCGCCCGGCCCCAGCCTGG - Intergenic
961212968 3:125140046-125140068 CACCATGCCCTGCCTCAGAGTGG + Intronic
961352178 3:126311058-126311080 GACCCTCCCCAGCCCCAGCCTGG - Intergenic
961451539 3:127004447-127004469 GACCCTGCCCTGGCCAAGCCAGG - Intronic
961501387 3:127338305-127338327 CACCTCTGCCTGCCCCAGACCGG - Intergenic
961636160 3:128334412-128334434 CACCCTGCCCTGCCAGACTCGGG - Intronic
961662565 3:128477440-128477462 TACCCTGCCAAGCCCCAGGCTGG + Intergenic
961769924 3:129241560-129241582 CACCGTGCCCGGCCCCAGCCTGG + Intergenic
962040792 3:131705561-131705583 CACCCTTTCCTTCCCCAGAGTGG - Intronic
962826986 3:139107568-139107590 CACCTTGCTCTGCCCTAGGCAGG - Intronic
964188621 3:153977237-153977259 CACCCTCCTCTGTCCCAGGCAGG + Intergenic
965733043 3:171792572-171792594 TTCCCTGCCCAGCCCCAGACTGG + Intronic
966908266 3:184543316-184543338 CACCATGCCCAGCCCCAAATGGG + Intronic
967171055 3:186824147-186824169 CCCTCTGCCCTGCCCTAGAACGG + Intergenic
967884339 3:194322906-194322928 CACCTTGCCCTGCCCCACCCAGG - Intergenic
967941196 3:194768006-194768028 CCCCAGGCCCTGCCCAAGACGGG - Intergenic
967975726 3:195033874-195033896 CGCCCTAGCCTGCCCCAGAAGGG - Intergenic
968472138 4:787033-787055 CACCCCTCCCTGCCCCGGGCCGG - Intronic
968596696 4:1489636-1489658 CACCCTCTCCTGCCCCTGCCAGG + Intergenic
968652054 4:1764018-1764040 CACCCAGCCCAGCCCCTGAAGGG - Intergenic
968652530 4:1765962-1765984 CATCCTGCCCCACCCCACACCGG - Intergenic
968858853 4:3150351-3150373 CAGGCTGCCCTGCCCAATACTGG - Intronic
969284344 4:6193467-6193489 ATCCCTACCCTGGCCCAGACTGG - Intronic
969300442 4:6294163-6294185 CCCTCTGCCCTGCCCCAGCATGG + Intronic
969457343 4:7307538-7307560 AGCCCTGACCTGCCCCAGCCTGG - Intronic
969692445 4:8711067-8711089 CACTCTGCCCTGCTCCTGGCAGG - Intergenic
969721607 4:8895397-8895419 GCCCCTCCCCTGCCCCACACTGG - Intergenic
970573443 4:17404906-17404928 CAGCTGCCCCTGCCCCAGACTGG + Intergenic
971395114 4:26220069-26220091 CACCCTGCCCAGCCAGAGCCAGG + Intronic
973907672 4:55547095-55547117 CACCGTTCCCTGCCCCGGCCGGG + Intronic
975383396 4:73727931-73727953 GACCCTGCCCTCCTCCAGTCTGG + Intergenic
976741084 4:88358287-88358309 CACCCACCCCTGCCCCAGTGGGG + Intergenic
977459615 4:97308962-97308984 CTCTCTCCCCTGCCCCAAACAGG + Intronic
977788962 4:101075130-101075152 CACCTGGCCCTGCCCTTGACAGG + Intronic
977965177 4:103137733-103137755 CATCCTGGCCTGGCCCAGAGAGG - Intronic
979474159 4:121135123-121135145 CACCATGTCCTGTCACAGACTGG + Intronic
980630557 4:135425844-135425866 CACCGTGCCCGGCCCCAAATTGG + Intergenic
980990403 4:139734633-139734655 CACCCTTACCTCCCCCAAACAGG + Intronic
981246392 4:142544687-142544709 CAGCCTGCCCTGTCTCATACAGG - Intronic
981337307 4:143581717-143581739 CCCCCTGCTCTTCACCAGACAGG + Intronic
981350456 4:143723440-143723462 CACCGTGCCCTGCCCTACAATGG - Intergenic
981874057 4:149519714-149519736 CACCATGCCCAGCCCAAAACAGG - Intergenic
981948912 4:150382333-150382355 CACCGTGCCCAGCCCCAGAATGG - Intronic
984503605 4:180589760-180589782 AACCCAGCCCTGCCCCCGCCCGG + Intergenic
984700106 4:182813783-182813805 CACCCGGCCCTGGCCCACCCTGG - Intergenic
984814209 4:183821925-183821947 CACCCTGCCCTTCCCTAAAAAGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
985628927 5:1004942-1004964 CGCCCTTCTCTGCCCCAGCCCGG - Intergenic
985645762 5:1084067-1084089 CACCCTGCACCTCCCAAGACAGG + Intronic
985669660 5:1200899-1200921 CACGCTGCCCAACCCCAGCCTGG - Intergenic
985692662 5:1322202-1322224 CCACCTGCTCTGCACCAGACAGG + Intronic
985888986 5:2701112-2701134 CACCCTGCCCTGCTCGCCACTGG + Intergenic
986876023 5:12110984-12111006 CACCCTGGACTTCCCCAGAGAGG + Intergenic
987291231 5:16510386-16510408 CACATTGCCCTGCCTCTGACAGG - Intronic
987878580 5:23711865-23711887 CCCCCTGGTCTTCCCCAGACAGG + Intergenic
989369524 5:40691602-40691624 CACCGTGCCCAGCCCATGACTGG + Intronic
989387300 5:40866525-40866547 CACCCAGACCTCACCCAGACTGG - Intergenic
989400620 5:41004224-41004246 TTCCTTGGCCTGCCCCAGACAGG - Intronic
990376545 5:55176469-55176491 CTCCCCGCCCTGCTCCAGGCTGG + Intergenic
990575733 5:57121673-57121695 CACCACGCCCGGCCCCAAACGGG - Intergenic
992529775 5:77643115-77643137 CACCTGACCCTGTCCCAGACTGG + Intergenic
993004688 5:82417603-82417625 CGCCCTGTCCTGCTGCAGACAGG - Intergenic
993037135 5:82770384-82770406 CACCGTGCCCAGCCTGAGACTGG - Intergenic
993300989 5:86209728-86209750 CACACTGCTGTGCTCCAGACTGG + Intergenic
993440381 5:87949872-87949894 CCCTCTGCCCTCCCCCAGTCTGG + Intergenic
993719887 5:91311831-91311853 TGCCCTGCCCTGACCCTGACTGG - Intergenic
995039019 5:107567559-107567581 CACCCACCCCTGCCCCAGGTTGG + Intronic
996803401 5:127428112-127428134 CACCATGGCCTGCCTCAGTCTGG - Intronic
997260841 5:132464549-132464571 CTCCATGCCCTGCTGCAGACAGG - Exonic
997356143 5:133264317-133264339 CCCACTGCCCTGCCCGAGGCAGG + Intronic
998140423 5:139696914-139696936 CACCCTCCCCTGCCCACCACAGG - Intergenic
998168142 5:139856143-139856165 GACCCTGCCCTGCTCCACAGTGG + Intronic
998455924 5:142273020-142273042 CACCGTGCCCAGCCCTAGAAAGG - Intergenic
999306932 5:150525566-150525588 CACCCTGTCCTGAGCCAGCCTGG - Intronic
999776588 5:154816917-154816939 CATCCAGCCGTGCCCCAGCCTGG + Exonic
1001175091 5:169460999-169461021 TTCCCTGCCTTACCCCAGACAGG + Intergenic
1001592796 5:172877920-172877942 TACCCGGCCCAGCCCCAGGCTGG - Intronic
1001889144 5:175324533-175324555 CTGCCTGCCCAGCCCCAGGCAGG + Intergenic
1002031867 5:176435754-176435776 CTACATGTCCTGCCCCAGACTGG + Intergenic
1002175445 5:177398943-177398965 CAGCCTGCCCTGCCCAGGCCAGG + Intergenic
1002376151 5:178790500-178790522 CACCCTGCCCCGCCCAGCACCGG + Intergenic
1002497065 5:179622951-179622973 CGCCCCGCCCCGCCCCAGCCCGG + Intronic
1005871369 6:29976396-29976418 CTGCCTCCCCTGCCCCAGAAAGG - Intergenic
1006504014 6:34476548-34476570 CACTTGGCCCTGCCCCAGATGGG + Intronic
1006514448 6:34538207-34538229 CTGCCTGCCCTGCCTCAGCCAGG - Exonic
1007053287 6:38855740-38855762 CACCCGGCCCGGCCACAAACCGG + Intronic
1007246533 6:40467324-40467346 CAGCTGGGCCTGCCCCAGACAGG - Intronic
1007302226 6:40876034-40876056 CCCCCAGCCCTCCCCCAGGCAGG - Intergenic
1007380930 6:41489687-41489709 CCCCCAGCCCAGCCCCAGGCAGG + Intergenic
1008493421 6:52109032-52109054 CACCCAGCCCTGCTGCAGATTGG - Intergenic
1010084628 6:71902675-71902697 CTCCCTCCCCTGCCCCCGACAGG + Intronic
1011530493 6:88315729-88315751 CACCCTGACCTCGCCCAGCCAGG - Intergenic
1013126511 6:107189623-107189645 CACTGTGCCCGGCCCCAGCCAGG + Intronic
1013430430 6:110050452-110050474 CATCCTTCCCTGCCTCACACTGG + Intergenic
1013608901 6:111775755-111775777 GATCCTGGCCTACCCCAGACTGG - Intronic
1015239634 6:131008502-131008524 CACCATGCAGTGCCCCAGAGGGG - Intronic
1015950958 6:138552130-138552152 CACCATGCCCGGCCCCAGGAGGG - Intronic
1016770971 6:147850731-147850753 CACCCTGTACTGCCCAAGATAGG + Intergenic
1016908445 6:149173868-149173890 CTGCCTCCCCTGCCCCAGGCAGG - Intergenic
1017012586 6:150072505-150072527 CAACCTGCCCTGGACCAGCCTGG - Intergenic
1017132024 6:151115614-151115636 CACCGTGCCCTCCCTCAGCCGGG + Intergenic
1017810711 6:157981762-157981784 CGCCCTCACCTGCCCCAGGCTGG + Intergenic
1018091101 6:160347823-160347845 TGCCCTGCCCTGCCCCACATGGG + Intergenic
1018576239 6:165262983-165263005 CAGCCTGCCCAGCCACAGTCAGG - Intergenic
1018812188 6:167306328-167306350 GACCCTGCCCTGCCCCACCCTGG - Intronic
1018902556 6:168058782-168058804 CAACCTGCCATGCAGCAGACTGG - Intronic
1018954291 6:168397793-168397815 CATCCTGTTCTGCACCAGACGGG + Intergenic
1019173573 6:170148312-170148334 CATCCTGTGCTGGCCCAGACAGG - Intergenic
1019325586 7:436745-436767 CACCATGGCCTGCTCCAGTCGGG + Intergenic
1019548061 7:1587878-1587900 GTCCCTGCCCTGCCCCTGATGGG - Intergenic
1019831030 7:3330682-3330704 CACCGTGCCTAGCCCTAGACTGG - Intronic
1020109351 7:5439573-5439595 CCCCCTGCCCCGCCCCCGCCTGG + Intronic
1021506313 7:21389399-21389421 CACCATGCCCGGCCTCAGGCTGG - Intergenic
1021516180 7:21489844-21489866 CACTGTGCCCAGCCCCAGGCTGG + Intronic
1021722620 7:23518627-23518649 CACCGTGCCCAGCCCAAAACTGG + Intronic
1022162521 7:27725960-27725982 CACCGTGCCCGGCCCCAAAAAGG + Intergenic
1022529779 7:31059741-31059763 AACCCTGCACTGCCCCCAACTGG - Intronic
1022659703 7:32355348-32355370 CACGCAGCCCTGCCCAAGAGGGG + Intergenic
1023010381 7:35920319-35920341 CACCATGCCCAGCCCCAGAAGGG - Intergenic
1023014789 7:35956066-35956088 CACCCCGCCATGCCCCCCACAGG - Intergenic
1023354719 7:39355192-39355214 CACCATGCCCTTCCCCAATCTGG - Intronic
1023959491 7:44914440-44914462 CACACTAGGCTGCCCCAGACTGG + Intergenic
1024066215 7:45738954-45738976 CACCCCGCCATGCCCCCCACAGG + Intergenic
1024080439 7:45851263-45851285 CACCATGCCCAGCCCCAGAAGGG + Intergenic
1024280562 7:47715690-47715712 TAACCTGCCCTGCCCCACGCAGG - Intronic
1024362263 7:48480471-48480493 TGCTCTGCCCTGCCACAGACCGG - Intronic
1024513492 7:50221623-50221645 CACACTCCCCTGCCCCATGCAGG - Intergenic
1025028522 7:55537178-55537200 GACCCTGCCCTGTCCCAACCAGG + Intronic
1025124026 7:56330413-56330435 CACCATGCCCAGCCCCAGAAGGG - Intergenic
1025825490 7:65007403-65007425 CACCATGCCCAGCCGCAGAAGGG - Intergenic
1025898499 7:65725215-65725237 CACCATGCCCAGCCGCAGAAGGG - Intergenic
1026343311 7:69452652-69452674 CACCATGCCAAGCCCCAGACTGG + Intergenic
1026736930 7:72954753-72954775 CACCCGGCTCTGCCCCCGCCCGG + Intergenic
1026878498 7:73893589-73893611 CACCTGGCCCTGGCCCAGCCTGG + Intergenic
1026891825 7:73986694-73986716 CACCGTGCCCTGACACTGACAGG + Intergenic
1027106802 7:75410310-75410332 CACCCGGCTCTGCCCCCGCCCGG - Intronic
1027194112 7:76017309-76017331 CACCGTGCCCGGCCCCAGATTGG + Intronic
1027390696 7:77700866-77700888 CACCGCGCCCGGCCCCAGAAGGG - Intronic
1029302817 7:99598406-99598428 CACCTTGCTCTCCCCCATACTGG - Intronic
1029990908 7:104961816-104961838 CACCGCGCCCGGCTCCAGACTGG + Intergenic
1030087616 7:105830421-105830443 CACCCAGCCCTGCCCCATGGCGG + Intronic
1030474704 7:110015975-110015997 CACCCTGCTCTGTGCCAGAGAGG - Intergenic
1031302973 7:120086674-120086696 CACCCTGCCCGGCCCCGGTCTGG - Intergenic
1032113676 7:129098871-129098893 CACCCAGCCCTGCCCCATGTTGG + Intergenic
1033206152 7:139424824-139424846 CTCCCTGCCCTACCCCTGCCAGG + Intergenic
1034256811 7:149729215-149729237 TCCCCTACCCTGCCCGAGACGGG - Exonic
1034272399 7:149809543-149809565 CCCCCTGCCTGGCCCCAGAGAGG + Intergenic
1034273115 7:149812682-149812704 CACCCTGCCCTCCCGCAAAGTGG - Intergenic
1034400055 7:150856333-150856355 CCCCTTGCCCTGCCCCAAGCTGG - Intronic
1034743409 7:153499526-153499548 CCCCCTGTCCACCCCCAGACTGG + Intergenic
1034939385 7:155220556-155220578 CCCCCAGCCCTGCCCCAGCCTGG + Intergenic
1035215573 7:157363952-157363974 CACCCAGCACTGCAGCAGACAGG - Intronic
1036545611 8:9766770-9766792 CACCGTGCCCAGCCCCAAATTGG + Intronic
1037880929 8:22573060-22573082 CCCCCTGCCCTGCCCCAAGCAGG + Intronic
1037986236 8:23292314-23292336 CACCGTGCCCAGCCACAGAAAGG - Intronic
1037995873 8:23352100-23352122 CACCGTGCCCAGCCCTGGACAGG + Intronic
1038407986 8:27336111-27336133 AAACCTGCCATGCCCCAGGCTGG - Intronic
1039161436 8:34626207-34626229 CACCGTGCCCAGCCCCAGGATGG - Intergenic
1040034315 8:42854035-42854057 CACACTGCCATGTACCAGACTGG - Exonic
1041145472 8:54871760-54871782 CATCCTGCCCTGTCCCATCCAGG + Intergenic
1041364858 8:57091673-57091695 CACCCTGCCCGGCCCAAATCTGG - Intergenic
1041691659 8:60693519-60693541 AACCTTGCCCTGCCCAAGACAGG - Intronic
1042268439 8:66932192-66932214 CACCATGCCCAGCCACAAACAGG - Intergenic
1042284632 8:67094558-67094580 CACCAGGCCCTGCCACAGAAAGG + Intronic
1042542293 8:69919371-69919393 CACCGTGCCCGGCCCCAGCCAGG - Intergenic
1043491331 8:80752030-80752052 CACCATGCCTGGCCCCAGTCAGG + Intronic
1044738922 8:95305557-95305579 CACCCTGCAGTGCCCCCTACTGG - Intergenic
1045270450 8:100656909-100656931 GACCCTGCTCTGTCCCAGTCTGG + Intronic
1046666203 8:117006386-117006408 CACCCTGCTCTTCCCAAAACAGG + Intronic
1046865871 8:119149780-119149802 CACCGTGCCCGGCCCGAGACTGG - Intergenic
1047237174 8:123052095-123052117 CACCATGCCTGGCCCAAGACAGG - Intronic
1047296368 8:123573804-123573826 CACCGTGCCCGGCCTGAGACAGG + Intergenic
1049022389 8:139966329-139966351 CACCCTGCCCTGGCAGAGAGAGG - Intronic
1049225683 8:141449471-141449493 CACCCAGTCCAGCCCCAGCCTGG - Intergenic
1049320288 8:141992585-141992607 CACCCTGACCTGATCCAGGCAGG - Intergenic
1049542766 8:143215925-143215947 CACCCTGCCCTTCCCCAGGTCGG + Intergenic
1051756999 9:20412504-20412526 CACCATGTCCTGACCCTGACTGG + Intronic
1052950172 9:34202418-34202440 CACCCTGCCCTGCCTGTGAGAGG + Intronic
1052965285 9:34335975-34335997 CACAGTGCCCTGCCTAAGACAGG - Intronic
1053428956 9:38029179-38029201 AACTCTGCCCAGCCCCAGCCTGG + Intronic
1055561439 9:77525829-77525851 CACCCGGCCGTGCCCCAGGATGG + Intronic
1056539483 9:87558967-87558989 TACCCTCCCCTCCCCCAGAGTGG - Intronic
1056968112 9:91180786-91180808 CTCGCTGCTCTGCCCCAGCCCGG + Intergenic
1057005408 9:91553327-91553349 CACCTTGCCCTGTCCCAGCTGGG - Intergenic
1057122180 9:92586378-92586400 CACCATCCCTTGCCCCAGGCAGG - Intronic
1057317398 9:93978623-93978645 CTCCCTGCCCCAACCCAGACAGG + Intergenic
1057436816 9:95048425-95048447 CACCCCGCCCCGCCCCGGATGGG - Intronic
1058432002 9:104928073-104928095 CGCCCTGCCCTGCCGCAGCCCGG + Exonic
1058452065 9:105106346-105106368 CACTGTGCCCTGCCTGAGACTGG + Intergenic
1058599653 9:106655476-106655498 CACCCAGCACTGACCCTGACTGG + Intergenic
1059391927 9:114004665-114004687 AGCCCTGCCCTGACCCAGACTGG + Intronic
1059698203 9:116748743-116748765 CACCCAGTCCTGCCCTGGACAGG + Intronic
1059830309 9:118087780-118087802 CACCTGGCCCTGCCCTTGACAGG - Intergenic
1060265382 9:122108929-122108951 CACCTGGCCCTGCCTCAGGCAGG + Intergenic
1060403486 9:123361504-123361526 CACCCTTCCCTCCCCCACTCTGG - Intronic
1060408390 9:123383913-123383935 CAGCCTGCTCTGTCCCCGACAGG - Exonic
1060799889 9:126537183-126537205 CAGCCCGCCCTCCTCCAGACGGG + Intergenic
1060828454 9:126699591-126699613 CACTCTGCCCAGCCCCGGACTGG + Exonic
1060985842 9:127818508-127818530 CCTCCTCCTCTGCCCCAGACAGG - Intronic
1060995563 9:127873475-127873497 CACCCTGCCCTTCCCCTCTCAGG + Intronic
1061032635 9:128095318-128095340 GGCCCTGCCCTGCCCTTGACAGG + Intronic
1061190815 9:129081543-129081565 CGCCCTCCCCTGTCCCAGAGAGG + Intronic
1061389815 9:130311240-130311262 CAGCCAGCCCTGGCCCAGCCTGG - Intronic
1061412118 9:130427479-130427501 GACCCCTTCCTGCCCCAGACAGG + Exonic
1061413316 9:130432516-130432538 CACCCTGTCCTGCCACCTACCGG + Exonic
1061623072 9:131824263-131824285 CAGCTTGCCCAGCCCCAGAATGG - Intergenic
1061749683 9:132769212-132769234 CACCCTGCCCTGCCACTGCCTGG + Intronic
1061792259 9:133064905-133064927 GGCGCTGCCCTGCCCCAGGCTGG - Intronic
1061805118 9:133133440-133133462 GACCCTGCTCTCCCCCAGGCTGG - Intronic
1061885313 9:133588248-133588270 CCTGCTGCTCTGCCCCAGACAGG - Intergenic
1061945985 9:133908385-133908407 CACCCTGTCCTTCCCCAGTGGGG + Intronic
1062012216 9:134273300-134273322 GATCCAGCCTTGCCCCAGACAGG + Intergenic
1062033350 9:134371955-134371977 CACCCAGTCCTGCACCAGGCTGG - Intronic
1062059480 9:134487306-134487328 CACCCTCCCCTGCTCCATGCAGG + Intergenic
1062154051 9:135036386-135036408 CCACCTGCCCTGCTCCAGGCAGG + Intergenic
1062170067 9:135129777-135129799 CACCTTGCTGTGCCCCAGTCGGG + Intergenic
1062395392 9:136350669-136350691 CACCCTGCCCTACCCCACCTGGG + Intronic
1062496409 9:136833557-136833579 CACCCTGGGCTGCCCCAGCTGGG + Intronic
1062507794 9:136886869-136886891 CACCCGGCCCTGCCCCGTCCCGG + Intronic
1062527787 9:136985262-136985284 CGCCCTCCCCCGACCCAGACAGG - Exonic
1185552390 X:993465-993487 CACCGCGCCCAGCCCGAGACTGG - Intergenic
1185558848 X:1043124-1043146 CACCATGCCCGGCCCCAGCTTGG + Intergenic
1185641393 X:1590645-1590667 CACCGGGCCCGGCCCCAGGCTGG + Intergenic
1189443831 X:41062121-41062143 CACCGTGCCCAGCCCCACAATGG - Intergenic
1190430219 X:50371638-50371660 CACCATGTCCTGGCCCACACTGG + Intronic
1192691775 X:73372704-73372726 CACCCCACCCTTCACCAGACAGG - Intergenic
1192698024 X:73438558-73438580 CACCAGGCCCTGCCCTTGACAGG + Intergenic
1194278167 X:91913205-91913227 CTCCCTCCCATCCCCCAGACTGG - Intronic
1194283402 X:91980721-91980743 CACCATGCCCAGCCCCAAACTGG + Intronic
1195716367 X:107822308-107822330 CACCGTGCCCAGCCCCTTACAGG + Intergenic
1196057452 X:111371264-111371286 CACCCATCCCTGCCCCTGAGAGG + Intronic
1196152619 X:112391996-112392018 CACCCTGCTCATCACCAGACAGG - Intergenic
1196447101 X:115851172-115851194 CAGCCTGCTCTGCGCCAGAAGGG + Intergenic
1196892720 X:120306535-120306557 AGCCCTCCCCTGCCCCAAACTGG + Intronic
1199065068 X:143406466-143406488 CACCATGCCCAGCCCGAGAGAGG + Intergenic
1199708155 X:150449113-150449135 CACCCTGCCCAACCACTGACTGG - Intronic
1200133183 X:153862464-153862486 CACGCTGCTCTGCCCCAGCTTGG - Exonic
1200595505 Y:5135280-5135302 CTCCCTCCCGTCCCCCAGACTGG - Intronic
1200600975 Y:5205255-5205277 CACCATGCCCAGCCCCAAACTGG + Intronic