ID: 1122781779

View in Genome Browser
Species Human (GRCh38)
Location 14:104146819-104146841
Sequence CGTGGAGACCGCCACGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 106}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122781772_1122781779 3 Left 1122781772 14:104146793-104146815 CCCGAGATGGGCCTGGCTGGAGC 0: 1
1: 0
2: 1
3: 24
4: 302
Right 1122781779 14:104146819-104146841 CGTGGAGACCGCCACGGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 106
1122781775_1122781779 -8 Left 1122781775 14:104146804-104146826 CCTGGCTGGAGCTCACGTGGAGA 0: 1
1: 0
2: 0
3: 10
4: 179
Right 1122781779 14:104146819-104146841 CGTGGAGACCGCCACGGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 106
1122781771_1122781779 4 Left 1122781771 14:104146792-104146814 CCCCGAGATGGGCCTGGCTGGAG 0: 1
1: 0
2: 0
3: 25
4: 182
Right 1122781779 14:104146819-104146841 CGTGGAGACCGCCACGGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 106
1122781766_1122781779 27 Left 1122781766 14:104146769-104146791 CCAAGGGGTGGGCATGTGAAAAG 0: 1
1: 0
2: 0
3: 25
4: 173
Right 1122781779 14:104146819-104146841 CGTGGAGACCGCCACGGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 106
1122781773_1122781779 2 Left 1122781773 14:104146794-104146816 CCGAGATGGGCCTGGCTGGAGCT 0: 1
1: 0
2: 0
3: 28
4: 252
Right 1122781779 14:104146819-104146841 CGTGGAGACCGCCACGGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122781779 Original CRISPR CGTGGAGACCGCCACGGGGC AGG Intronic
900553278 1:3267500-3267522 CGTGGAGAGCGCCCTGGGTCTGG + Intronic
900745107 1:4355737-4355759 TGTGGAGCCTGACACGGGGCAGG + Intergenic
900800807 1:4735878-4735900 CGTGGAGACCCTCAGGAGGCGGG - Intronic
902392779 1:16115915-16115937 CATGGAGACAGCCACGGGGGTGG + Intergenic
903318113 1:22524800-22524822 CTTGGAGAGCGCCTCTGGGCAGG + Intronic
904701809 1:32362285-32362307 CGTGGACGCCGCCTCGCGGCGGG - Exonic
905369220 1:37474464-37474486 CCGGGAGACCGCCCCGGGGGCGG - Intergenic
907409136 1:54272604-54272626 AGTGGAGACCCCTGCGGGGCTGG - Intronic
915461305 1:156072268-156072290 GGTGGAGACAGCCCTGGGGCAGG - Exonic
919894385 1:201999918-201999940 CTTGGAGGCTGCAACGGGGCGGG + Exonic
923684189 1:236142582-236142604 CGCGGAGACCCCCGCGGGGGCGG + Exonic
924775172 1:247111360-247111382 GGTGGAGAGAGCCGCGGGGCAGG + Exonic
1069417116 10:68210323-68210345 CGTAGCGACTGCCACTGGGCCGG - Exonic
1073081889 10:100865601-100865623 CGTGGAGACAGACACAGGTCAGG - Intergenic
1074483897 10:113854624-113854646 CGTGGGGACCGAAAAGGGGCGGG + Intergenic
1077228966 11:1450273-1450295 CGTGGAGGTGGCCAGGGGGCGGG - Intronic
1079450531 11:20597157-20597179 CGTGGAGACTGCCGCGCGTCAGG - Intergenic
1089467085 11:118692324-118692346 CGGGCAGACCACCAAGGGGCAGG + Intergenic
1202828158 11_KI270721v1_random:99791-99813 GGTGGAGCTCGCCACGGGGGGGG + Intergenic
1097435537 12:59549082-59549104 GGTGGAGCCCACCACAGGGCAGG - Intergenic
1100131699 12:91502447-91502469 CCTAGATACTGCCACGGGGCTGG - Intergenic
1100391468 12:94148964-94148986 CCGGGAGACCTCCATGGGGCTGG - Exonic
1104755575 12:131267205-131267227 GCTGGAGAAAGCCACGGGGCGGG - Intergenic
1115969412 14:38928768-38928790 GGTGGATACAGACACGGGGCTGG + Intergenic
1119421988 14:74512666-74512688 CGGGGACATCGCCACAGGGCAGG + Intronic
1122781779 14:104146819-104146841 CGTGGAGACCGCCACGGGGCAGG + Intronic
1125664257 15:41417479-41417501 CTTGGAGACCGGCCCGGGCCTGG + Intronic
1128742940 15:70096130-70096152 GGTGGGGGCCGCCCCGGGGCTGG - Intronic
1128936024 15:71747154-71747176 CGTCCAGACCCCCACGGGACGGG - Intronic
1129221471 15:74134038-74134060 CGGGGAGACCGAGACGGAGCCGG + Exonic
1132939914 16:2501481-2501503 GGTGGGGTCCGCCAGGGGGCAGG - Exonic
1133220167 16:4316280-4316302 CGTGGGGACCGGGCCGGGGCGGG + Intronic
1137673726 16:50293557-50293579 CGGGGAGGCCGCCTGGGGGCCGG - Intronic
1142000534 16:87661731-87661753 CCCGCAGGCCGCCACGGGGCGGG + Intronic
1145712360 17:26989465-26989487 TGTGGAGACAGCCACCTGGCAGG + Intergenic
1146295932 17:31650194-31650216 AGTGGAGTCAGCCAGGGGGCTGG - Intergenic
1147123826 17:38352286-38352308 CGTGGAGGCGGCCCCGGAGCCGG + Exonic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1148211931 17:45813865-45813887 CGTGGAGACCTTCAAGGGGTGGG - Intronic
1151909518 17:77072882-77072904 CATGGAGACCACCCGGGGGCAGG - Intergenic
1152375453 17:79916347-79916369 CGTGCAAACAGCCAGGGGGCAGG - Intergenic
1152772631 17:82179609-82179631 GGTGGACCCAGCCACGGGGCGGG + Intronic
1153522159 18:5963441-5963463 GGTGGAGGCCACCACGGGGCAGG - Intronic
1156171651 18:34493645-34493667 AGAGGAGCCCGCCGCGGGGCGGG + Intronic
1160418484 18:78728086-78728108 CGTGGAGGCAGCGACAGGGCAGG + Intergenic
1160662587 19:308085-308107 GGTGGAGACCCACACGGGGAGGG - Intronic
1160833553 19:1114111-1114133 GGTGGTGACCGCCAGGAGGCCGG + Intronic
1160994389 19:1875983-1876005 CGTGGGGGCCGCCGCGGGGTCGG - Intergenic
1161374717 19:3933524-3933546 CCTGGAGGCCGCCCCGGGGGAGG - Exonic
1161979771 19:7624316-7624338 GATGGAGACCGCCTCGGAGCTGG - Exonic
1165089203 19:33373857-33373879 AGTGGAGGCCGCCTGGGGGCAGG + Exonic
1165862958 19:38918668-38918690 TGAGGAGACCGCCCTGGGGCTGG - Intronic
1166754003 19:45179476-45179498 CGCGGAGACCGACTCGGAGCCGG + Exonic
1167485973 19:49763172-49763194 CGGGGACACCCCCACGGGGGTGG - Exonic
1168317423 19:55490270-55490292 AGTGGAGACAGCCAGGGGTCAGG - Intronic
1168692879 19:58387338-58387360 AGGTGAGACCGCCGCGGGGCCGG + Exonic
925893949 2:8457179-8457201 CGTGGAGGCCGCTCCCGGGCGGG + Intergenic
927428657 2:23008219-23008241 AGTGGAGATGGCCATGGGGCTGG + Intergenic
932495760 2:72145002-72145024 CGTGGAGACCTCAGAGGGGCGGG + Intronic
935904412 2:107827505-107827527 CATCGAGGCCGCCACCGGGCCGG - Intronic
935904644 2:107828415-107828437 CATCGAGGCCGCCGCGGGGCCGG - Intronic
935904771 2:107828915-107828937 CATCGAGGCCGCCGCGGGGCCGG - Intronic
935904841 2:107829185-107829207 CATGGAGGCCGCCGCCGGGCCGG - Intronic
937044068 2:118841852-118841874 GGAGGAGGCCGCCACTGGGCTGG + Intergenic
937990479 2:127659414-127659436 CGTGGAGACCAGCAGGGAGCTGG - Intronic
937998856 2:127715989-127716011 GGTGGAGACAGACACAGGGCAGG + Intronic
946013873 2:216588407-216588429 CGTGGAGACTGGCAGGGGGCGGG - Intergenic
946856683 2:223957302-223957324 GGCGGAGACAGCCCCGGGGCGGG - Intergenic
947667991 2:231919045-231919067 CCTGGGAAACGCCACGGGGCTGG - Intergenic
948155661 2:235778886-235778908 AGTGAGGACTGCCACGGGGCTGG - Intronic
949043300 2:241859114-241859136 TGGGGAGACCCCCACGGGGTAGG - Intergenic
1172635391 20:36406568-36406590 TGTGGGGACCTCCAGGGGGCTGG + Intronic
1175960559 20:62634446-62634468 CAGGGAGACCGTCCCGGGGCCGG - Intergenic
1180090857 21:45533280-45533302 CGTGGAGCTGGGCACGGGGCTGG + Intronic
1183582464 22:38734087-38734109 TGTGGAGACAGCCACAAGGCAGG - Intronic
1184022973 22:41833306-41833328 CATGGAGACCCTCACGGAGCTGG + Exonic
1184288109 22:43483385-43483407 GGTGGAGCACGCCATGGGGCAGG - Intronic
1184414520 22:44344504-44344526 CGTGGAGACCCCCTCTGGGCTGG - Intergenic
952108201 3:30092938-30092960 CCTGGAGACCGCCCAGGGCCTGG + Intergenic
953771297 3:45780186-45780208 TGTGGCGACCGCCCCGGGGTGGG + Intronic
953901460 3:46846187-46846209 CGTGGAAACCGCAGCGGGGCGGG - Intergenic
955692729 3:61606280-61606302 TGTGGAGACAGCCACGTCGCAGG - Intronic
962751618 3:138437963-138437985 CGTGGAAACCTTCACGAGGCGGG - Intronic
968361151 3:198147861-198147883 CCTGGAGACAGACACTGGGCAGG - Intergenic
968579602 4:1383794-1383816 CGTGGAAGCAGCCACAGGGCAGG + Exonic
969492108 4:7505309-7505331 CGGGGAGCCAGGCACGGGGCTGG + Intronic
981741273 4:148004581-148004603 TGTGGAGAGGGCCACGTGGCAGG + Intronic
985630049 5:1009359-1009381 CCTGGAGACCGCGCAGGGGCAGG - Intronic
986291070 5:6399111-6399133 AGTGGAGACAGGGACGGGGCCGG - Intergenic
986518624 5:8590401-8590423 TGTGGAGACTGCCACATGGCTGG - Intergenic
992105555 5:73447325-73447347 CGCGGAGGCCGGCAGGGGGCCGG + Exonic
1002784789 6:392652-392674 CGTGGAGGCCGCCAGGGGAGTGG + Intronic
1003603733 6:7541722-7541744 CGCGGAGACGGCGACGGGCCGGG - Exonic
1005385262 6:25279352-25279374 CGGGGAGAGCGGCGCGGGGCGGG - Intronic
1005915228 6:30345397-30345419 CGGTGAGACAGCCACGGGGCGGG + Exonic
1006300776 6:33192626-33192648 CGTTGAGACCTACAAGGGGCAGG - Intergenic
1006380211 6:33692914-33692936 TGTGGAGGCCGCAGCGGGGCTGG + Intronic
1007254738 6:40520781-40520803 CATGGAGACCACGAAGGGGCTGG - Intronic
1018100195 6:160431282-160431304 AGTGGCGGCCGCCACGGCGCAGG + Intronic
1018123948 6:160663972-160663994 CGTGAAGACTGTCACGGTGCTGG - Intronic
1018400078 6:163413819-163413841 CGTCGGGCCCGCCACGGCGCGGG - Intergenic
1018612703 6:165660925-165660947 CGGGAAGACCGCGGCGGGGCCGG - Intronic
1019254536 7:40860-40882 CCTGGAGACAGACACTGGGCAGG + Intergenic
1024586283 7:50844752-50844774 CGAGGAGAGCGCCAAGGGGATGG - Intergenic
1026557737 7:71422625-71422647 CCTGGAGACCGCCATGGGGTCGG - Intronic
1032174370 7:129611770-129611792 CGTGGAGACTGCGACCGCGCCGG - Exonic
1034201716 7:149286935-149286957 GGTGGAGACCACCCTGGGGCTGG + Intronic
1037393607 8:18419745-18419767 GGTGGAGATCGCCACGGGGTGGG + Intergenic
1049442087 8:142614235-142614257 CGTGGAGCCCGCCGCTGGTCCGG + Exonic
1051339906 9:16101712-16101734 TGTGGAGAAGGCCACAGGGCAGG + Intergenic
1056760196 9:89409022-89409044 CGTGGAGACAGCCCAGGGGCAGG + Intronic
1061349681 9:130054256-130054278 CGGGCTGACCGGCACGGGGCGGG + Intronic
1062745863 9:138211693-138211715 CCTGGAGACAGACACTGGGCAGG - Intergenic
1185761237 X:2691184-2691206 CGTGGAGGCCGGGGCGGGGCGGG + Exonic
1186611065 X:11139057-11139079 CGTGGAGACACCCACGGACCAGG - Exonic
1197865601 X:131013365-131013387 CGTGGAGAGCGCCAGAGGGTGGG + Intergenic
1200292649 X:154886967-154886989 CGTGAAGACCGCCAGGGCGCCGG - Exonic
1200339493 X:155382707-155382729 CGTGAAGACCGCCAGGGCGCCGG - Exonic
1200346977 X:155457986-155458008 CGTGAAGACCGCCAGGGCGCCGG + Exonic